Prepare the TAIR10 reference genome sequence in fasta format and genome annotation in gff format
wget https://www.arabidopsis.org/download_files/Genes/TAIR10_genome_release/TAIR10_gff3/TAIR10_GFF3_genes.gff
wget ftp://ftp.arabidopsis.org/home/tair/Sequences/whole_chromosomes/TAIR10_chr1.fas
wget ftp://ftp.arabidopsis.org/home/tair/Sequences/whole_chromosomes/TAIR10_chr2.fas
wget ftp://ftp.arabidopsis.org/home/tair/Sequences/whole_chromosomes/TAIR10_chr3.fas
wget ftp://ftp.arabidopsis.org/home/tair/Sequences/whole_chromosomes/TAIR10_chr4.fas
wget ftp://ftp.arabidopsis.org/home/tair/Sequences/whole_chromosomes/TAIR10_chr5.fas
cat TAIR10_chr1.fas TAIR10_chr2.fas TAIR10_chr3.fas TAIR10_chr4.fas TAIR10_chr5.fas > tair10.fa
Download the sdi files for 18 Arabidopsis inbreeding lines
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/bur_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/can_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/ct_1.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/edi_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/hi_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/kn_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/ler_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/mt_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/no_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/oy_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/po_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/rsch_4.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/sf_2.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/tsu_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/wil_2.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/ws_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/wu_0.v7c.sdi
wget http://mtweb.cs.ucl.ac.uk/mus/www/19genomes/variants.SDI/zu_0.v7c.sdi
Generate synthesis genome sequences using the software GEAN https://github.com/baoxingsong/GEAN/
PLEASE NOTE: GEAN gave error message with the downloaded SDI file for ler_0 no_0 and oy_0. We removed the records
Chr4 6020491 12 AAGACATCAATATCATCAGGAAAAATACTCATTCTATTATTAG TAATGACTTAGAGAATAAACTACGAATACAAAAAAAAAAACTCATTATATATCAT 5
Chr4 6020491 33 - TAATGACTTAGAGAATAAACTACGAATACAAAA 4
from ler_0.v7c.sdi,
And removed
Chr5 8499298 -1 CAACAAGTTAAAGATTTAAGGTTTTAAAATCCATTTTATAAATAAATTTTTATTGCAAAACTATATTGGAAATCAGAGAAATTTGAAAAATTCACTTTTAAAGTTTTTTAATAACTGATAACGTACTACTTCAAAAACTGTAAACCAAATGCTAAGAATGCATATATGTTTCTGGCAACAAAGAGATAACAGATA GAGTGATAAAAAGATAAATAGCCTATCTTTTTGTTGGATATCCAACAAGTTGAAGGTTAAGGTTTTAAAAGATCCCAGTTTATAGCAAAACTTAAGTTAGAAATCAGAGATATATATTTACAAAAATCACTATTCAATTTTTTTTATAATTGATTACTACTTCAAAAACTAGAAACCAAAAGCCAAGAATGTAT 5
Chr5 8499298 42 - GAGTGATAAAAAGATAAATAGCCTATCTTTTTGTTGGATATC 4
from no_0.v7c.sdi, and removed
Chr2 7677637 7 ACAAGATAAATATTTAAAAATATATTTCTTAGA GCTAAAGTAATGAAAAAGTGTTTCTAAAACACTAGTTAAT 5
Chr2 7677637 8 - GCTAAAGT 4
from oy_0.v7c.sdi manually.
gean pseudogeno -r tair10.fa -v bur_0.v7c.sdi -o bur_0.fa
gean pseudogeno -r tair10.fa -v can_0.v7c.sdi -o can_0.fa
gean pseudogeno -r tair10.fa -v ct_1.v7c.sdi -o ct_1.fa
gean pseudogeno -r tair10.fa -v edi_0.v7c.sdi -o edi_0.fa
gean pseudogeno -r tair10.fa -v hi_0.v7c.sdi -o hi_0.fa
gean pseudogeno -r tair10.fa -v kn_0.v7c.sdi -o kn_0.fa
gean pseudogeno -r tair10.fa -v ler_0.v7c.sdi -o ler_0.fa
gean pseudogeno -r tair10.fa -v mt_0.v7c.sdi -o mt_0.fa
gean pseudogeno -r tair10.fa -v no_0.v7c.sdi -o no_0.fa
gean pseudogeno -r tair10.fa -v oy_0.v7c.sdi -o oy_0.fa
gean pseudogeno -r tair10.fa -v po_0.v7c.sdi -o po_0.fa
gean pseudogeno -r tair10.fa -v rsch_4.v7c.sdi -o rsch_4.fa
gean pseudogeno -r tair10.fa -v sf_2.v7c.sdi -o sf_2.fa
gean pseudogeno -r tair10.fa -v tsu_0.v7c.sdi -o tsu_0.fa
gean pseudogeno -r tair10.fa -v wil_2.v7c.sdi -o wil_2.fa
gean pseudogeno -r tair10.fa -v ws_0.v7c.sdi -o ws_0.fa
gean pseudogeno -r tair10.fa -v wu_0.v7c.sdi -o wu_0.fa
gean pseudogeno -r tair10.fa -v zu_0.v7c.sdi -o zu_0.fa
Check the variants length distribution
awk '{ print length($4)"\t"length($5) }' bur_0.v7c.sdi > bur_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' can_0.v7c.sdi > can_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' ct_1.v7c.sdi > ct_1.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' edi_0.v7c.sdi > edi_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' hi_0.v7c.sdi > hi_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' kn_0.v7c.sdi > kn_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' ler_0.v7c.sdi > ler_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' mt_0.v7c.sdi > mt_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' no_0.v7c.sdi > no_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' oy_0.v7c.sdi > oy_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' po_0.v7c.sdi > po_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' rsch_4.v7c.sdi > rsch_4.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' sf_2.v7c.sdi > sf_2.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' tsu_0.v7c.sdi > tsu_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' wil_2.v7c.sdi > wil_2.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' ws_0.v7c.sdi > ws_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' wu_0.v7c.sdi > wu_0.v7c.sdi.length
awk '{ print length($4)"\t"length($5) }' zu_0.v7c.sdi > zu_0.v7c.sdi.length
samtools faidx tair10.fa
Plot variants length distribution
faidx = read.table("tair10.fa.fai")
genome_size = sum(faidx$V2)
library(ggplot2)
library(data.table)
library(dplyr)
##
## Attaching package: 'dplyr'
## The following objects are masked from 'package:data.table':
##
## between, first, last
## The following objects are masked from 'package:stats':
##
## filter, lag
## The following objects are masked from 'package:base':
##
## intersect, setdiff, setequal, union
variant_length_distribution <- function(accession) {
dat = read.table(accession)
print ( paste("Total number of variant sites affected reference genome:", sum(dat$V1), sep="") )
print ( paste("Total number of variant sites with length >= 50bp affected reference genome:", sum(dat[which(dat$V1>=50),]$V1), sep="") )
print ( paste("Total number of variants affected reference genome:", sum(dat$V1)/genome_size, sep="") )
print ( paste("Total length of variants with length >= 50bp affected reference genome:", sum(dat[which(dat$V1>=50),]$V1)/genome_size, sep="") )
dat$length = dat$V1
dat[which(dat$V1 < dat$V2),]$length = dat[which(dat$V1 < dat$V2),]$V2
df<- dat[order(dat$length),] %>% mutate(CUMFREQ=cumsum(length))
p = ggplot(data=df, aes(x=length, y=CUMFREQ)) + geom_area( fill = "#00BFC4", position = 'identity') + labs(x="Variant length", y="Cumulative length", fill="", title="") + xlim(0, 65000) + ylim(0, 5200000)+
theme_grey(base_size = 36) +
theme(axis.line = element_blank(), panel.background = element_blank(),panel.border = element_rect(fill=NA,color="black", size=0.5, linetype="solid") )
print(p)
}
variant_length_distribution("bur_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3572234"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2344643"
## [1] "Total number of variants affected reference genome:0.0299819009139919"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0196786812131246"
variant_length_distribution("can_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:4294813"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2840010"
## [1] "Total number of variants affected reference genome:0.0360465349722679"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0238363159901468"
variant_length_distribution("ct_1.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3321803"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2226794"
## [1] "Total number of variants affected reference genome:0.0278800236495709"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0186895699060789"
variant_length_distribution("edi_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3424359"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2265270"
## [1] "Total number of variants affected reference genome:0.0287407802041906"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0190125004922518"
variant_length_distribution("hi_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:2542703"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:1464496"
## [1] "Total number of variants affected reference genome:0.0213410066081085"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0122915727135841"
variant_length_distribution("kn_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3501200"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2323051"
## [1] "Total number of variants affected reference genome:0.0293857097491566"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0194974587051548"
variant_length_distribution("ler_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3566615"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2379766"
## [1] "Total number of variants affected reference genome:0.0299347404252793"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0199734699379959"
variant_length_distribution("mt_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3406350"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2367168"
## [1] "Total number of variants affected reference genome:0.0285896299565976"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0198677344269083"
variant_length_distribution("no_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3546602"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2413442"
## [1] "Total number of variants affected reference genome:0.0297667705266132"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0202561139347721"
variant_length_distribution("oy_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3357745"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2280457"
## [1] "Total number of variants affected reference genome:0.0281816862737581"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0191399655824952"
variant_length_distribution("po_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:2603041"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:1450924"
## [1] "Total number of variants affected reference genome:0.0218474258229048"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0121776623820648"
variant_length_distribution("rsch_4.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3332735"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2254537"
## [1] "Total number of variants affected reference genome:0.027971776356922"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0189224179997527"
variant_length_distribution("sf_2.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3704993"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2427158"
## [1] "Total number of variants affected reference genome:0.0310961524393513"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0203712328639733"
variant_length_distribution("tsu_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3624832"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2483334"
## [1] "Total number of variants affected reference genome:0.0304233580033859"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0208427202485468"
variant_length_distribution("wil_2.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3840435"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2624879"
## [1] "Total number of variants affected reference genome:0.0322329224895756"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0220307130185811"
variant_length_distribution("ws_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3511980"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2312792"
## [1] "Total number of variants affected reference genome:0.0294761867145101"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0194113545133586"
variant_length_distribution("wu_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3373410"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2281978"
## [1] "Total number of variants affected reference genome:0.0283131632368623"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0191527313955103"
variant_length_distribution("zu_0.v7c.sdi.length")
## [1] "Total number of variant sites affected reference genome:3499427"
## [1] "Total number of variant sites with length >= 50bp affected reference genome:2336951"
## [1] "Total number of variants affected reference genome:0.0293708288901981"
## [1] "Total length of variants with length >= 50bp affected reference genome:0.0196141219536162"
Transform sdi file into maf format
anchorwave sdiToMaf -o col_bur.maf -r tair10.fa -s bur_0.v7c.sdi -q bur_0.fa
anchorwave sdiToMaf -o col_can.maf -r tair10.fa -s can_0.v7c.sdi -q can_0.fa
anchorwave sdiToMaf -o col_ct.maf -r tair10.fa -s ct_1.v7c.sdi -q ct_1.fa
anchorwave sdiToMaf -o col_edi.maf -r tair10.fa -s edi_0.v7c.sdi -q edi_0.fa
anchorwave sdiToMaf -o col_hi.maf -r tair10.fa -s hi_0.v7c.sdi -q hi_0.fa
anchorwave sdiToMaf -o col_kn.maf -r tair10.fa -s kn_0.v7c.sdi -q kn_0.fa
anchorwave sdiToMaf -o col_ler.maf -r tair10.fa -s ler_0.v7c.sdi -q ler_0.fa
anchorwave sdiToMaf -o col_mt.maf -r tair10.fa -s mt_0.v7c.sdi -q mt_0.fa
anchorwave sdiToMaf -o col_no.maf -r tair10.fa -s no_0.v7c.sdi -q no_0.fa
anchorwave sdiToMaf -o col_oy.maf -r tair10.fa -s oy_0.v7c.sdi -q oy_0.fa
anchorwave sdiToMaf -o col_po.maf -r tair10.fa -s po_0.v7c.sdi -q po_0.fa
anchorwave sdiToMaf -o col_rsch.maf -r tair10.fa -s rsch_4.v7c.sdi -q rsch_4.fa
anchorwave sdiToMaf -o col_sf.maf -r tair10.fa -s sf_2.v7c.sdi -q sf_2.fa
anchorwave sdiToMaf -o col_tsu.maf -r tair10.fa -s tsu_0.v7c.sdi -q tsu_0.fa
anchorwave sdiToMaf -o col_wil.maf -r tair10.fa -s wil_2.v7c.sdi -q wil_2.fa
anchorwave sdiToMaf -o col_ws.maf -r tair10.fa -s ws_0.v7c.sdi -q ws_0.fa
anchorwave sdiToMaf -o col_wu.maf -r tair10.fa -s wu_0.v7c.sdi -q wu_0.fa
anchorwave sdiToMaf -o col_zu.maf -r tair10.fa -s zu_0.v7c.sdi -q zu_0.fa
Using AnchorWave to extract full-length CDS.
NOTE: please do NOT use CDS extracted using other software and do NOT use the output full-length CDS file for other purpose. Since AnchorWave filtered some CDS records to minimum the impact of minimap2 limitation on genome alignment that “Minimap2 often misses small exons” (https://github.com/lh3/minimap2#limitations)
anchorwave gff2seq -r tair10.fa -i TAIR10_GFF3_genes.gff -o cds.fa
Use minimap2 (https://github.com/lh3/minimap2) to map the extracted sequence to the TAIR10 reference genome sequence and synthesis genomes
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 tair10.fa cds.fa > ref.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 bur_0.fa cds.fa > bur_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 can_0.fa cds.fa > can_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 ct_1.fa cds.fa > ct_1.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 edi_0.fa cds.fa > edi_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 hi_0.fa cds.fa > hi_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 kn_0.fa cds.fa > kn_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 ler_0.fa cds.fa > ler_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 mt_0.fa cds.fa > mt_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 no_0.fa cds.fa > no_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 oy_0.fa cds.fa > oy_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 po_0.fa cds.fa > po_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 rsch_4.fa cds.fa > rsch_4.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 sf_2.fa cds.fa > sf_2.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 tsu_0.fa cds.fa > tsu_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 wil_2.fa cds.fa > wil_2.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 ws_0.fa cds.fa > ws_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 wu_0.fa cds.fa > wu_0.sam
minimap2 -x splice -t 6 -k 12 -a -p 0.4 -N 20 zu_0.fa cds.fa > zu_0.sam
Perform genome alignment using AnchorWave
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a bur_0.sam -ar ref.sam -s bur_0.fa -v bur_0.vcf -n bur_0.anchors -o bur_0.maf -f bur_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >bur_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a can_0.sam -ar ref.sam -s can_0.fa -v can_0.vcf -n can_0.anchors -o can_0.maf -f can_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >can_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a ct_1.sam -ar ref.sam -s ct_1.fa -v ct_1.vcf -n ct_1.anchors -o ct_1.maf -f ct_1.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >ct_1.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a edi_0.sam -ar ref.sam -s edi_0.fa -v edi_0.vcf -n edi_0.anchors -o edi_0.maf -f edi_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >edi_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a hi_0.sam -ar ref.sam -s hi_0.fa -v hi_0.vcf -n hi_0.anchors -o hi_0.maf -f hi_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >hi_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a kn_0.sam -ar ref.sam -s kn_0.fa -v kn_0.vcf -n kn_0.anchors -o kn_0.maf -f kn_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >kn_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a ler_0.sam -ar ref.sam -s ler_0.fa -v ler_0.vcf -n ler_0.anchors -o ler_0.maf -f ler_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >ler_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a mt_0.sam -ar ref.sam -s mt_0.fa -v mt_0.vcf -n mt_0.anchors -o mt_0.maf -f mt_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >mt_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a no_0.sam -ar ref.sam -s no_0.fa -v no_0.vcf -n no_0.anchors -o no_0.maf -f no_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >no_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a oy_0.sam -ar ref.sam -s oy_0.fa -v oy_0.vcf -n oy_0.anchors -o oy_0.maf -f oy_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >oy_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a po_0.sam -ar ref.sam -s po_0.fa -v po_0.vcf -n po_0.anchors -o po_0.maf -f po_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >po_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a rsch_4.sam -ar ref.sam -s rsch_4.fa -v rsch_4.vcf -n rsch_4.anchors -o rsch_4.maf -f rsch_4.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >rsch_4.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a sf_2.sam -ar ref.sam -s sf_2.fa -v sf_2.vcf -n sf_2.anchors -o sf_2.maf -f sf_2.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >sf_2.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a tsu_0.sam -ar ref.sam -s tsu_0.fa -v tsu_0.vcf -n tsu_0.anchors -o tsu_0.maf -f tsu_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >tsu_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a wil_2.sam -ar ref.sam -s wil_2.fa -v wil_2.vcf -n wil_2.anchors -o wil_2.maf -f wil_2.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >wil_2.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a ws_0.sam -ar ref.sam -s ws_0.fa -v ws_0.vcf -n ws_0.anchors -o ws_0.maf -f ws_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >ws_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a wu_0.sam -ar ref.sam -s wu_0.fa -v wu_0.vcf -n wu_0.anchors -o wu_0.maf -f wu_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >wu_0.log 2>&1 &
/usr/bin/time anchorwave genoAli -i TAIR10_GFF3_genes.gff -as cds.fa -r tair10.fa -a zu_0.sam -ar ref.sam -s zu_0.fa -v zu_0.vcf -n zu_0.anchors -o zu_0.maf -f zu_0.f.maf -w 38000 -fa3 200000 -B -6 -O1 -8 -E1 -2 -O2 -75 -E2 -1 -t 1 >zu_0.log 2>&1 &
Compare produced genome alignment with benchmark genome alignment
CompareMafAndCheckMafCoverage.py is a script included in the released code and located at ./src/tests/scripts/CompareMafAndCheckMafCoverage.py
sed -i 's/tair10.fa./col./g' bur_0.maf
sed -i 's/bur_0.fa./query./g' bur_0.maf
sed -i 's/tair10.fa./col./g' can_0.maf
sed -i 's/can_0.fa./query./g' can_0.maf
sed -i 's/tair10.fa./col./g' ct_1.maf
sed -i 's/ct_1.fa./query./g' ct_1.maf
sed -i 's/tair10.fa./col./g' edi_0.maf
sed -i 's/edi_0.fa./query./g' edi_0.maf
sed -i 's/tair10.fa./col./g' hi_0.maf
sed -i 's/hi_0.fa./query./g' hi_0.maf
sed -i 's/tair10.fa./col./g' kn_0.maf
sed -i 's/kn_0.fa./query./g' kn_0.maf
sed -i 's/tair10.fa./col./g' ler_0.maf
sed -i 's/ler_0.fa./query./g' ler_0.maf
sed -i 's/tair10.fa./col./g' mt_0.maf
sed -i 's/mt_0.fa./query./g' mt_0.maf
sed -i 's/tair10.fa./col./g' no_0.maf
sed -i 's/no_0.fa./query./g' no_0.maf
sed -i 's/tair10.fa./col./g' oy_0.maf
sed -i 's/oy_0.fa./query./g' oy_0.maf
sed -i 's/tair10.fa./col./g' po_0.maf
sed -i 's/po_0.fa./query./g' po_0.maf
sed -i 's/tair10.fa./col./g' rsch_4.maf
sed -i 's/rsch_4.fa./query./g' rsch_4.maf
sed -i 's/tair10.fa./col./g' sf_2.maf
sed -i 's/sf_2.fa./query./g' sf_2.maf
sed -i 's/tair10.fa./col./g' tsu_0.maf
sed -i 's/tsu_0.fa./query./g' tsu_0.maf
sed -i 's/tair10.fa./col./g' wil_2.maf
sed -i 's/wil_2.fa./query./g' wil_2.maf
sed -i 's/tair10.fa./col./g' ws_0.maf
sed -i 's/ws_0.fa./query./g' ws_0.maf
sed -i 's/tair10.fa./col./g' wu_0.maf
sed -i 's/wu_0.fa./query./g' wu_0.maf
sed -i 's/tair10.fa./col./g' zu_0.maf
sed -i 's/zu_0.fa./query./g' zu_0.maf
python3 CompareMafAndCheckMafCoverage.py ./col_bur.maf bur_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_can.maf can_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_ct.maf ct_1.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_edi.maf edi_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_hi.maf hi_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_kn.maf kn_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_ler.maf ler_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_mt.maf mt_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_no.maf no_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_oy.maf oy_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_po.maf po_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_rsch.maf rsch_4.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_sf.maf sf_2.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_tsu.maf tsu_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_wil.maf wil_2.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_ws.maf ws_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_wu.maf wu_0.maf &
python3 CompareMafAndCheckMafCoverage.py ./col_zu.maf zu_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_bur.maf bur_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_can.maf can_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_ct.maf ct_1.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_edi.maf edi_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_hi.maf hi_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_kn.maf kn_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_ler.maf ler_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_mt.maf mt_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_no.maf no_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_oy.maf oy_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_po.maf po_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_rsch.maf rsch_4.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_sf.maf sf_2.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_tsu.maf tsu_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_wil.maf wil_2.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_ws.maf ws_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_wu.maf wu_0.maf &
python3 CompareMafAndCheckMafCoverageAll.py ./col_zu.maf zu_0.maf &
Perform genome alignment using minimap2
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa bur_0.fa > minimap2_asm5_bur_0.sam 2> minimap2_asm5_bur_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa can_0.fa > minimap2_asm5_can_0.sam 2> minimap2_asm5_can_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa ct_1.fa > minimap2_asm5_ct_1.sam 2> minimap2_asm5_ct_1.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa edi_0.fa > minimap2_asm5_edi_0.sam 2> minimap2_asm5_edi_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa hi_0.fa > minimap2_asm5_hi_0.sam 2> minimap2_asm5_hi_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa kn_0.fa > minimap2_asm5_kn_0.sam 2> minimap2_asm5_kn_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa ler_0.fa > minimap2_asm5_ler_0.sam 2> minimap2_asm5_ler_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa mt_0.fa > minimap2_asm5_mt_0.sam 2> minimap2_asm5_mt_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa no_0.fa > minimap2_asm5_no_0.sam 2> minimap2_asm5_no_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa oy_0.fa > minimap2_asm5_oy_0.sam 2> minimap2_asm5_oy_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa po_0.fa > minimap2_asm5_po_0.sam 2> minimap2_asm5_po_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa rsch_4.fa > minimap2_asm5_rsch_4.sam 2> minimap2_asm5_rsch_4.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa sf_2.fa > minimap2_asm5_sf_2.sam 2> minimap2_asm5_sf_2.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa tsu_0.fa > minimap2_asm5_tsu_0.sam 2> minimap2_asm5_tsu_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa wil_2.fa > minimap2_asm5_wil_2.sam 2> minimap2_asm5_wil_2.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa ws_0.fa > minimap2_asm5_ws_0.sam 2> minimap2_asm5_ws_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa wu_0.fa > minimap2_asm5_wu_0.sam 2> minimap2_asm5_wu_0.log &
/usr/bin/time minimap2 -x asm5 -t 1 -a tair10.fa zu_0.fa > minimap2_asm5_zu_0.sam 2> minimap2_asm5_zu_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa bur_0.fa > minimap2_asm10_bur_0.sam 2> minimap2_asm10_bur_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa can_0.fa > minimap2_asm10_can_0.sam 2> minimap2_asm10_can_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa ct_1.fa > minimap2_asm10_ct_1.sam 2> minimap2_asm10_ct_1.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa edi_0.fa > minimap2_asm10_edi_0.sam 2> minimap2_asm10_edi_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa hi_0.fa > minimap2_asm10_hi_0.sam 2> minimap2_asm10_hi_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa kn_0.fa > minimap2_asm10_kn_0.sam 2> minimap2_asm10_kn_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa ler_0.fa > minimap2_asm10_ler_0.sam 2> minimap2_asm10_ler_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa mt_0.fa > minimap2_asm10_mt_0.sam 2> minimap2_asm10_mt_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa no_0.fa > minimap2_asm10_no_0.sam 2> minimap2_asm10_no_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa oy_0.fa > minimap2_asm10_oy_0.sam 2> minimap2_asm10_oy_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa po_0.fa > minimap2_asm10_po_0.sam 2> minimap2_asm10_po_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa rsch_4.fa > minimap2_asm10_rsch_4.sam 2> minimap2_asm10_rsch_4.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa sf_2.fa > minimap2_asm10_sf_2.sam 2> minimap2_asm10_sf_2.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa tsu_0.fa > minimap2_asm10_tsu_0.sam 2> minimap2_asm10_tsu_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa wil_2.fa > minimap2_asm10_wil_2.sam 2> minimap2_asm10_wil_2.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa ws_0.fa > minimap2_asm10_ws_0.sam 2> minimap2_asm10_ws_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa wu_0.fa > minimap2_asm10_wu_0.sam 2> minimap2_asm10_wu_0.log &
/usr/bin/time minimap2 -x asm10 -t 1 -a tair10.fa zu_0.fa > minimap2_asm10_zu_0.sam 2> minimap2_asm10_zu_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa bur_0.fa > minimap2_asm20_bur_0.sam 2> minimap2_asm20_bur_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa can_0.fa > minimap2_asm20_can_0.sam 2> minimap2_asm20_can_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa ct_1.fa > minimap2_asm20_ct_1.sam 2> minimap2_asm20_ct_1.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa edi_0.fa > minimap2_asm20_edi_0.sam 2> minimap2_asm20_edi_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa hi_0.fa > minimap2_asm20_hi_0.sam 2> minimap2_asm20_hi_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa kn_0.fa > minimap2_asm20_kn_0.sam 2> minimap2_asm20_kn_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa ler_0.fa > minimap2_asm20_ler_0.sam 2> minimap2_asm20_ler_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa mt_0.fa > minimap2_asm20_mt_0.sam 2> minimap2_asm20_mt_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa no_0.fa > minimap2_asm20_no_0.sam 2> minimap2_asm20_no_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa oy_0.fa > minimap2_asm20_oy_0.sam 2> minimap2_asm20_oy_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa po_0.fa > minimap2_asm20_po_0.sam 2> minimap2_asm20_po_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa rsch_4.fa > minimap2_asm20_rsch_4.sam 2> minimap2_asm20_rsch_4.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa sf_2.fa > minimap2_asm20_sf_2.sam 2> minimap2_asm20_sf_2.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa tsu_0.fa > minimap2_asm20_tsu_0.sam 2> minimap2_asm20_tsu_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa wil_2.fa > minimap2_asm20_wil_2.sam 2> minimap2_asm20_wil_2.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa ws_0.fa > minimap2_asm20_ws_0.sam 2> minimap2_asm20_ws_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa wu_0.fa > minimap2_asm20_wu_0.sam 2> minimap2_asm20_wu_0.log &
/usr/bin/time minimap2 -x asm20 -t 1 -a tair10.fa zu_0.fa > minimap2_asm20_zu_0.sam 2> minimap2_asm20_zu_0.log &
Reformat sam files into maf format
anchorwave sam2maf -r tair10.fa -q bur_0.fa -s minimap2_asm5_bur_0.sam -o minimap2_asm5_bur_0.maf
anchorwave sam2maf -r tair10.fa -q can_0.fa -s minimap2_asm5_can_0.sam -o minimap2_asm5_can_0.maf
anchorwave sam2maf -r tair10.fa -q ct_1.fa -s minimap2_asm5_ct_1.sam -o minimap2_asm5_ct_1.maf
anchorwave sam2maf -r tair10.fa -q edi_0.fa -s minimap2_asm5_edi_0.sam -o minimap2_asm5_edi_0.maf
anchorwave sam2maf -r tair10.fa -q hi_0.fa -s minimap2_asm5_hi_0.sam -o minimap2_asm5_hi_0.maf
anchorwave sam2maf -r tair10.fa -q kn_0.fa -s minimap2_asm5_kn_0.sam -o minimap2_asm5_kn_0.maf
anchorwave sam2maf -r tair10.fa -q ler_0.fa -s minimap2_asm5_ler_0.sam -o minimap2_asm5_ler_0.maf
anchorwave sam2maf -r tair10.fa -q mt_0.fa -s minimap2_asm5_mt_0.sam -o minimap2_asm5_mt_0.maf
anchorwave sam2maf -r tair10.fa -q no_0.fa -s minimap2_asm5_no_0.sam -o minimap2_asm5_no_0.maf
anchorwave sam2maf -r tair10.fa -q oy_0.fa -s minimap2_asm5_oy_0.sam -o minimap2_asm5_oy_0.maf
anchorwave sam2maf -r tair10.fa -q po_0.fa -s minimap2_asm5_po_0.sam -o minimap2_asm5_po_0.maf
anchorwave sam2maf -r tair10.fa -q rsch_4.fa -s minimap2_asm5_rsch_4.sam -o minimap2_asm5_rsch_4.maf
anchorwave sam2maf -r tair10.fa -q sf_2.fa -s minimap2_asm5_sf_2.sam -o minimap2_asm5_sf_2.maf
anchorwave sam2maf -r tair10.fa -q tsu_0.fa -s minimap2_asm5_tsu_0.sam -o minimap2_asm5_tsu_0.maf
anchorwave sam2maf -r tair10.fa -q wil_2.fa -s minimap2_asm5_wil_2.sam -o minimap2_asm5_wil_2.maf
anchorwave sam2maf -r tair10.fa -q ws_0.fa -s minimap2_asm5_ws_0.sam -o minimap2_asm5_ws_0.maf
anchorwave sam2maf -r tair10.fa -q wu_0.fa -s minimap2_asm5_wu_0.sam -o minimap2_asm5_wu_0.maf
anchorwave sam2maf -r tair10.fa -q zu_0.fa -s minimap2_asm5_zu_0.sam -o minimap2_asm5_zu_0.maf
anchorwave sam2maf -r tair10.fa -q bur_0.fa -s minimap2_asm10_bur_0.sam -o minimap2_asm10_bur_0.maf
anchorwave sam2maf -r tair10.fa -q can_0.fa -s minimap2_asm10_can_0.sam -o minimap2_asm10_can_0.maf
anchorwave sam2maf -r tair10.fa -q ct_1.fa -s minimap2_asm10_ct_1.sam -o minimap2_asm10_ct_1.maf
anchorwave sam2maf -r tair10.fa -q edi_0.fa -s minimap2_asm10_edi_0.sam -o minimap2_asm10_edi_0.maf
anchorwave sam2maf -r tair10.fa -q hi_0.fa -s minimap2_asm10_hi_0.sam -o minimap2_asm10_hi_0.maf
anchorwave sam2maf -r tair10.fa -q kn_0.fa -s minimap2_asm10_kn_0.sam -o minimap2_asm10_kn_0.maf
anchorwave sam2maf -r tair10.fa -q ler_0.fa -s minimap2_asm10_ler_0.sam -o minimap2_asm10_ler_0.maf
anchorwave sam2maf -r tair10.fa -q mt_0.fa -s minimap2_asm10_mt_0.sam -o minimap2_asm10_mt_0.maf
anchorwave sam2maf -r tair10.fa -q no_0.fa -s minimap2_asm10_no_0.sam -o minimap2_asm10_no_0.maf
anchorwave sam2maf -r tair10.fa -q oy_0.fa -s minimap2_asm10_oy_0.sam -o minimap2_asm10_oy_0.maf
anchorwave sam2maf -r tair10.fa -q po_0.fa -s minimap2_asm10_po_0.sam -o minimap2_asm10_po_0.maf
anchorwave sam2maf -r tair10.fa -q rsch_4.fa -s minimap2_asm10_rsch_4.sam -o minimap2_asm10_rsch_4.maf
anchorwave sam2maf -r tair10.fa -q sf_2.fa -s minimap2_asm10_sf_2.sam -o minimap2_asm10_sf_2.maf
anchorwave sam2maf -r tair10.fa -q tsu_0.fa -s minimap2_asm10_tsu_0.sam -o minimap2_asm10_tsu_0.maf
anchorwave sam2maf -r tair10.fa -q wil_2.fa -s minimap2_asm10_wil_2.sam -o minimap2_asm10_wil_2.maf
anchorwave sam2maf -r tair10.fa -q ws_0.fa -s minimap2_asm10_ws_0.sam -o minimap2_asm10_ws_0.maf
anchorwave sam2maf -r tair10.fa -q wu_0.fa -s minimap2_asm10_wu_0.sam -o minimap2_asm10_wu_0.maf
anchorwave sam2maf -r tair10.fa -q zu_0.fa -s minimap2_asm10_zu_0.sam -o minimap2_asm10_zu_0.maf
anchorwave sam2maf -r tair10.fa -q bur_0.fa -s minimap2_asm20_bur_0.sam -o minimap2_asm20_bur_0.maf
anchorwave sam2maf -r tair10.fa -q can_0.fa -s minimap2_asm20_can_0.sam -o minimap2_asm20_can_0.maf
anchorwave sam2maf -r tair10.fa -q ct_1.fa -s minimap2_asm20_ct_1.sam -o minimap2_asm20_ct_1.maf
anchorwave sam2maf -r tair10.fa -q edi_0.fa -s minimap2_asm20_edi_0.sam -o minimap2_asm20_edi_0.maf
anchorwave sam2maf -r tair10.fa -q hi_0.fa -s minimap2_asm20_hi_0.sam -o minimap2_asm20_hi_0.maf
anchorwave sam2maf -r tair10.fa -q kn_0.fa -s minimap2_asm20_kn_0.sam -o minimap2_asm20_kn_0.maf
anchorwave sam2maf -r tair10.fa -q ler_0.fa -s minimap2_asm20_ler_0.sam -o minimap2_asm20_ler_0.maf
anchorwave sam2maf -r tair10.fa -q mt_0.fa -s minimap2_asm20_mt_0.sam -o minimap2_asm20_mt_0.maf
anchorwave sam2maf -r tair10.fa -q no_0.fa -s minimap2_asm20_no_0.sam -o minimap2_asm20_no_0.maf
anchorwave sam2maf -r tair10.fa -q oy_0.fa -s minimap2_asm20_oy_0.sam -o minimap2_asm20_oy_0.maf
anchorwave sam2maf -r tair10.fa -q po_0.fa -s minimap2_asm20_po_0.sam -o minimap2_asm20_po_0.maf
anchorwave sam2maf -r tair10.fa -q rsch_4.fa -s minimap2_asm20_rsch_4.sam -o minimap2_asm20_rsch_4.maf
anchorwave sam2maf -r tair10.fa -q sf_2.fa -s minimap2_asm20_sf_2.sam -o minimap2_asm20_sf_2.maf
anchorwave sam2maf -r tair10.fa -q tsu_0.fa -s minimap2_asm20_tsu_0.sam -o minimap2_asm20_tsu_0.maf
anchorwave sam2maf -r tair10.fa -q wil_2.fa -s minimap2_asm20_wil_2.sam -o minimap2_asm20_wil_2.maf
anchorwave sam2maf -r tair10.fa -q ws_0.fa -s minimap2_asm20_ws_0.sam -o minimap2_asm20_ws_0.maf
anchorwave sam2maf -r tair10.fa -q wu_0.fa -s minimap2_asm20_wu_0.sam -o minimap2_asm20_wu_0.maf
anchorwave sam2maf -r tair10.fa -q zu_0.fa -s minimap2_asm20_zu_0.sam -o minimap2_asm20_zu_0.maf
Evaluated the performance of minimap2
python3 CompareMafAndCheckMafCoverage.py col_bur.maf minimap2_asm5_bur_0.maf
python3 CompareMafAndCheckMafCoverage.py col_can.maf minimap2_asm5_can_0.maf
python3 CompareMafAndCheckMafCoverage.py col_ct.maf minimap2_asm5_ct_1.maf
python3 CompareMafAndCheckMafCoverage.py col_edi.maf minimap2_asm5_edi_0.maf
python3 CompareMafAndCheckMafCoverage.py col_hi.maf minimap2_asm5_hi_0.maf
python3 CompareMafAndCheckMafCoverage.py col_kn.maf minimap2_asm5_kn_0.maf
python3 CompareMafAndCheckMafCoverage.py col_ler.maf minimap2_asm5_ler_0.maf
python3 CompareMafAndCheckMafCoverage.py col_mt.maf minimap2_asm5_mt_0.maf
python3 CompareMafAndCheckMafCoverage.py col_no.maf minimap2_asm5_no_0.maf
python3 CompareMafAndCheckMafCoverage.py col_oy.maf minimap2_asm5_oy_0.maf
python3 CompareMafAndCheckMafCoverage.py col_po.maf minimap2_asm5_po_0.maf
python3 CompareMafAndCheckMafCoverage.py col_rsch.maf minimap2_asm5_rsch_4.maf
python3 CompareMafAndCheckMafCoverage.py col_sf.maf minimap2_asm5_sf_2.maf
python3 CompareMafAndCheckMafCoverage.py col_tsu.maf minimap2_asm5_tsu_0.maf
python3 CompareMafAndCheckMafCoverage.py col_wil.maf minimap2_asm5_wil_2.maf
python3 CompareMafAndCheckMafCoverage.py col_ws.maf minimap2_asm5_ws_0.maf
python3 CompareMafAndCheckMafCoverage.py col_wu.maf minimap2_asm5_wu_0.maf
python3 CompareMafAndCheckMafCoverage.py col_zu.maf minimap2_asm5_zu_0.maf
python3 CompareMafAndCheckMafCoverage.py col_bur.maf minimap2_asm10_bur_0.maf
python3 CompareMafAndCheckMafCoverage.py col_can.maf minimap2_asm10_can_0.maf
python3 CompareMafAndCheckMafCoverage.py col_ct.maf minimap2_asm10_ct_1.maf
python3 CompareMafAndCheckMafCoverage.py col_edi.maf minimap2_asm10_edi_0.maf
python3 CompareMafAndCheckMafCoverage.py col_hi.maf minimap2_asm10_hi_0.maf
python3 CompareMafAndCheckMafCoverage.py col_kn.maf minimap2_asm10_kn_0.maf
python3 CompareMafAndCheckMafCoverage.py col_ler.maf minimap2_asm10_ler_0.maf
python3 CompareMafAndCheckMafCoverage.py col_mt.maf minimap2_asm10_mt_0.maf
python3 CompareMafAndCheckMafCoverage.py col_no.maf minimap2_asm10_no_0.maf
python3 CompareMafAndCheckMafCoverage.py col_oy.maf minimap2_asm10_oy_0.maf
python3 CompareMafAndCheckMafCoverage.py col_po.maf minimap2_asm10_po_0.maf
python3 CompareMafAndCheckMafCoverage.py col_rsch.maf minimap2_asm10_rsch_4.maf
python3 CompareMafAndCheckMafCoverage.py col_sf.maf minimap2_asm10_sf_2.maf
python3 CompareMafAndCheckMafCoverage.py col_tsu.maf minimap2_asm10_tsu_0.maf
python3 CompareMafAndCheckMafCoverage.py col_wil.maf minimap2_asm10_wil_2.maf
python3 CompareMafAndCheckMafCoverage.py col_ws.maf minimap2_asm10_ws_0.maf
python3 CompareMafAndCheckMafCoverage.py col_wu.maf minimap2_asm10_wu_0.maf
python3 CompareMafAndCheckMafCoverage.py col_zu.maf minimap2_asm10_zu_0.maf
python3 CompareMafAndCheckMafCoverage.py col_bur.maf minimap2_asm20_bur_0.maf
python3 CompareMafAndCheckMafCoverage.py col_can.maf minimap2_asm20_can_0.maf
python3 CompareMafAndCheckMafCoverage.py col_ct.maf minimap2_asm20_ct_1.maf
python3 CompareMafAndCheckMafCoverage.py col_edi.maf minimap2_asm20_edi_0.maf
python3 CompareMafAndCheckMafCoverage.py col_hi.maf minimap2_asm20_hi_0.maf
python3 CompareMafAndCheckMafCoverage.py col_kn.maf minimap2_asm20_kn_0.maf
python3 CompareMafAndCheckMafCoverage.py col_ler.maf minimap2_asm20_ler_0.maf
python3 CompareMafAndCheckMafCoverage.py col_mt.maf minimap2_asm20_mt_0.maf
python3 CompareMafAndCheckMafCoverage.py col_no.maf minimap2_asm20_no_0.maf
python3 CompareMafAndCheckMafCoverage.py col_oy.maf minimap2_asm20_oy_0.maf
python3 CompareMafAndCheckMafCoverage.py col_po.maf minimap2_asm20_po_0.maf
python3 CompareMafAndCheckMafCoverage.py col_rsch.maf minimap2_asm20_rsch_4.maf
python3 CompareMafAndCheckMafCoverage.py col_sf.maf minimap2_asm20_sf_2.maf
python3 CompareMafAndCheckMafCoverage.py col_tsu.maf minimap2_asm20_tsu_0.maf
python3 CompareMafAndCheckMafCoverage.py col_wil.maf minimap2_asm20_wil_2.maf
python3 CompareMafAndCheckMafCoverage.py col_ws.maf minimap2_asm20_ws_0.maf
python3 CompareMafAndCheckMafCoverage.py col_wu.maf minimap2_asm20_wu_0.maf
python3 CompareMafAndCheckMafCoverage.py col_zu.maf minimap2_asm20_zu_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_bur.maf minimap2_asm5_bur_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_can.maf minimap2_asm5_can_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ct.maf minimap2_asm5_ct_1.maf
python3 CompareMafAndCheckMafCoverageAll.py col_edi.maf minimap2_asm5_edi_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_hi.maf minimap2_asm5_hi_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_kn.maf minimap2_asm5_kn_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ler.maf minimap2_asm5_ler_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_mt.maf minimap2_asm5_mt_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_no.maf minimap2_asm5_no_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_oy.maf minimap2_asm5_oy_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_po.maf minimap2_asm5_po_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_rsch.maf minimap2_asm5_rsch_4.maf
python3 CompareMafAndCheckMafCoverageAll.py col_sf.maf minimap2_asm5_sf_2.maf
python3 CompareMafAndCheckMafCoverageAll.py col_tsu.maf minimap2_asm5_tsu_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wil.maf minimap2_asm5_wil_2.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ws.maf minimap2_asm5_ws_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wu.maf minimap2_asm5_wu_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_zu.maf minimap2_asm5_zu_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_bur.maf minimap2_asm10_bur_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_can.maf minimap2_asm10_can_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ct.maf minimap2_asm10_ct_1.maf
python3 CompareMafAndCheckMafCoverageAll.py col_edi.maf minimap2_asm10_edi_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_hi.maf minimap2_asm10_hi_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_kn.maf minimap2_asm10_kn_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ler.maf minimap2_asm10_ler_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_mt.maf minimap2_asm10_mt_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_no.maf minimap2_asm10_no_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_oy.maf minimap2_asm10_oy_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_po.maf minimap2_asm10_po_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_rsch.maf minimap2_asm10_rsch_4.maf
python3 CompareMafAndCheckMafCoverageAll.py col_sf.maf minimap2_asm10_sf_2.maf
python3 CompareMafAndCheckMafCoverageAll.py col_tsu.maf minimap2_asm10_tsu_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wil.maf minimap2_asm10_wil_2.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ws.maf minimap2_asm10_ws_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wu.maf minimap2_asm10_wu_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_zu.maf minimap2_asm10_zu_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_bur.maf minimap2_asm20_bur_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_can.maf minimap2_asm20_can_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ct.maf minimap2_asm20_ct_1.maf
python3 CompareMafAndCheckMafCoverageAll.py col_edi.maf minimap2_asm20_edi_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_hi.maf minimap2_asm20_hi_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_kn.maf minimap2_asm20_kn_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ler.maf minimap2_asm20_ler_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_mt.maf minimap2_asm20_mt_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_no.maf minimap2_asm20_no_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_oy.maf minimap2_asm20_oy_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_po.maf minimap2_asm20_po_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_rsch.maf minimap2_asm20_rsch_4.maf
python3 CompareMafAndCheckMafCoverageAll.py col_sf.maf minimap2_asm20_sf_2.maf
python3 CompareMafAndCheckMafCoverageAll.py col_tsu.maf minimap2_asm20_tsu_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wil.maf minimap2_asm20_wil_2.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ws.maf minimap2_asm20_ws_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wu.maf minimap2_asm20_wu_0.maf
python3 CompareMafAndCheckMafCoverageAll.py col_zu.maf minimap2_asm20_zu_0.maf
Perform genome alignment using the LAST pipeline
# The header of MAF file do not compatible between the LAST pipeline and the chain pipeline.
# We implemented lastToMafComparsion.pl and lastFinalToSplit.pl to reformat the header of MAF files to make them compatible with the used software.
lastdb col tair10.fa
faToTwoBit tair10.fa col.2bit
faSize -detailed tair10.fa > col.size
lastal col bur_0.fa > bur_0_lastal.maf
faSize -detailed bur_0.fa > bur_0.size
faToTwoBit bur_0.fa bur_0.2bit
maf-convert psl bur_0_lastal.maf > bur_0_lastal.psl
axtChain -linearGap=loose -psl bur_0_lastal.psl -faQ -faT tair10.fa bur_0.fa bur_0_lastal.chain
chainMergeSort bur_0_lastal.chain > bur_0_lastal.all.chain
chainPreNet bur_0_lastal.all.chain col.size bur_0.size bur_0_lastal.preNet
chainNet bur_0_lastal.preNet col.size bur_0.size bur_0_lastal.refTarget.net bur_0_lastal.chainNet
netToAxt bur_0_lastal.refTarget.net bur_0_lastal.preNet col.2bit bur_0.2bit stdout | axtSort stdin bur_0_lastal.axt
axtToMaf bur_0_lastal.axt col.size bur_0.size bur_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl bur_0_lastal_final.maf > bur_0_lastal_final_forsplit.maf
cat bur_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > bur_0_lastal_split.maf
cat bur_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > bur_0_lastal_final_split.maf
perl lastToMafComparsion.pl bur_0_lastal_split.maf > bur_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl bur_0_lastal_final_split.maf > bur_0_lastal_final_split_Comparator.maf
lastal col can_0.fa > can_0_lastal.maf
faSize -detailed can_0.fa > can_0.size
faToTwoBit can_0.fa can_0.2bit
maf-convert psl can_0_lastal.maf > can_0_lastal.psl
axtChain -linearGap=loose -psl can_0_lastal.psl -faQ -faT tair10.fa can_0.fa can_0_lastal.chain
chainMergeSort can_0_lastal.chain > can_0_lastal.all.chain
chainPreNet can_0_lastal.all.chain col.size can_0.size can_0_lastal.preNet
chainNet can_0_lastal.preNet col.size can_0.size can_0_lastal.refTarget.net can_0_lastal.chainNet
netToAxt can_0_lastal.refTarget.net can_0_lastal.preNet col.2bit can_0.2bit stdout | axtSort stdin can_0_lastal.axt
axtToMaf can_0_lastal.axt col.size can_0.size can_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl can_0_lastal_final.maf > can_0_lastal_final_forsplit.maf
cat can_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > can_0_lastal_split.maf
cat can_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > can_0_lastal_final_split.maf
perl lastToMafComparsion.pl can_0_lastal_split.maf > can_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl can_0_lastal_final_split.maf > can_0_lastal_final_split_Comparator.maf
lastal col ct_1.fa > ct_1_lastal.maf
faSize -detailed ct_1.fa > ct_1.size
faToTwoBit ct_1.fa ct_1.2bit
maf-convert psl ct_1_lastal.maf > ct_1_lastal.psl
axtChain -linearGap=loose -psl ct_1_lastal.psl -faQ -faT tair10.fa ct_1.fa ct_1_lastal.chain
chainMergeSort ct_1_lastal.chain > ct_1_lastal.all.chain
chainPreNet ct_1_lastal.all.chain col.size ct_1.size ct_1_lastal.preNet
chainNet ct_1_lastal.preNet col.size ct_1.size ct_1_lastal.refTarget.net ct_1_lastal.chainNet
netToAxt ct_1_lastal.refTarget.net ct_1_lastal.preNet col.2bit ct_1.2bit stdout | axtSort stdin ct_1_lastal.axt
axtToMaf ct_1_lastal.axt col.size ct_1.size ct_1_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl ct_1_lastal_final.maf > ct_1_lastal_final_forsplit.maf
cat ct_1_lastal.maf | last-split | maf-swap | last-split | maf-swap > ct_1_lastal_split.maf
cat ct_1_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > ct_1_lastal_final_split.maf
perl lastToMafComparsion.pl ct_1_lastal_split.maf > ct_1_lastal_split_Comparator.maf
perl lastToMafComparsion.pl ct_1_lastal_final_split.maf > ct_1_lastal_final_split_Comparator.maf
lastal col edi_0.fa > edi_0_lastal.maf
faSize -detailed edi_0.fa > edi_0.size
faToTwoBit edi_0.fa edi_0.2bit
maf-convert psl edi_0_lastal.maf > edi_0_lastal.psl
axtChain -linearGap=loose -psl edi_0_lastal.psl -faQ -faT tair10.fa edi_0.fa edi_0_lastal.chain
chainMergeSort edi_0_lastal.chain > edi_0_lastal.all.chain
chainPreNet edi_0_lastal.all.chain col.size edi_0.size edi_0_lastal.preNet
chainNet edi_0_lastal.preNet col.size edi_0.size edi_0_lastal.refTarget.net edi_0_lastal.chainNet
netToAxt edi_0_lastal.refTarget.net edi_0_lastal.preNet col.2bit edi_0.2bit stdout | axtSort stdin edi_0_lastal.axt
axtToMaf edi_0_lastal.axt col.size edi_0.size edi_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl edi_0_lastal_final.maf > edi_0_lastal_final_forsplit.maf
cat edi_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > edi_0_lastal_split.maf
cat edi_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > edi_0_lastal_final_split.maf
perl lastToMafComparsion.pl edi_0_lastal_split.maf > edi_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl edi_0_lastal_final_split.maf > edi_0_lastal_final_split_Comparator.maf
lastal col hi_0.fa > hi_0_lastal.maf
faSize -detailed hi_0.fa > hi_0.size
faToTwoBit hi_0.fa hi_0.2bit
maf-convert psl hi_0_lastal.maf > hi_0_lastal.psl
axtChain -linearGap=loose -psl hi_0_lastal.psl -faQ -faT tair10.fa hi_0.fa hi_0_lastal.chain
chainMergeSort hi_0_lastal.chain > hi_0_lastal.all.chain
chainPreNet hi_0_lastal.all.chain col.size hi_0.size hi_0_lastal.preNet
chainNet hi_0_lastal.preNet col.size hi_0.size hi_0_lastal.refTarget.net hi_0_lastal.chainNet
netToAxt hi_0_lastal.refTarget.net hi_0_lastal.preNet col.2bit hi_0.2bit stdout | axtSort stdin hi_0_lastal.axt
axtToMaf hi_0_lastal.axt col.size hi_0.size hi_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl hi_0_lastal_final.maf > hi_0_lastal_final_forsplit.maf
cat hi_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > hi_0_lastal_split.maf
cat hi_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > hi_0_lastal_final_split.maf
perl lastToMafComparsion.pl hi_0_lastal_split.maf > hi_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl hi_0_lastal_final_split.maf > hi_0_lastal_final_split_Comparator.maf
lastal col kn_0.fa > kn_0_lastal.maf
faSize -detailed kn_0.fa > kn_0.size
faToTwoBit kn_0.fa kn_0.2bit
maf-convert psl kn_0_lastal.maf > kn_0_lastal.psl
axtChain -linearGap=loose -psl kn_0_lastal.psl -faQ -faT tair10.fa kn_0.fa kn_0_lastal.chain
chainMergeSort kn_0_lastal.chain > kn_0_lastal.all.chain
chainPreNet kn_0_lastal.all.chain col.size kn_0.size kn_0_lastal.preNet
chainNet kn_0_lastal.preNet col.size kn_0.size kn_0_lastal.refTarget.net kn_0_lastal.chainNet
netToAxt kn_0_lastal.refTarget.net kn_0_lastal.preNet col.2bit kn_0.2bit stdout | axtSort stdin kn_0_lastal.axt
axtToMaf kn_0_lastal.axt col.size kn_0.size kn_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl kn_0_lastal_final.maf > kn_0_lastal_final_forsplit.maf
cat kn_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > kn_0_lastal_split.maf
cat kn_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > kn_0_lastal_final_split.maf
perl lastToMafComparsion.pl kn_0_lastal_split.maf > kn_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl kn_0_lastal_final_split.maf > kn_0_lastal_final_split_Comparator.maf
lastal col ler_0.fa > ler_0_lastal.maf
faSize -detailed ler_0.fa > ler_0.size
faToTwoBit ler_0.fa ler_0.2bit
maf-convert psl ler_0_lastal.maf > ler_0_lastal.psl
axtChain -linearGap=loose -psl ler_0_lastal.psl -faQ -faT tair10.fa ler_0.fa ler_0_lastal.chain
chainMergeSort ler_0_lastal.chain > ler_0_lastal.all.chain
chainPreNet ler_0_lastal.all.chain col.size ler_0.size ler_0_lastal.preNet
chainNet ler_0_lastal.preNet col.size ler_0.size ler_0_lastal.refTarget.net ler_0_lastal.chainNet
netToAxt ler_0_lastal.refTarget.net ler_0_lastal.preNet col.2bit ler_0.2bit stdout | axtSort stdin ler_0_lastal.axt
axtToMaf ler_0_lastal.axt col.size ler_0.size ler_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl ler_0_lastal_final.maf > ler_0_lastal_final_forsplit.maf
cat ler_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > ler_0_lastal_split.maf
cat ler_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > ler_0_lastal_final_split.maf
perl lastToMafComparsion.pl ler_0_lastal_split.maf > ler_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl ler_0_lastal_final_split.maf > ler_0_lastal_final_split_Comparator.maf
lastal col mt_0.fa > mt_0_lastal.maf
faSize -detailed mt_0.fa > mt_0.size
faToTwoBit mt_0.fa mt_0.2bit
maf-convert psl mt_0_lastal.maf > mt_0_lastal.psl
axtChain -linearGap=loose -psl mt_0_lastal.psl -faQ -faT tair10.fa mt_0.fa mt_0_lastal.chain
chainMergeSort mt_0_lastal.chain > mt_0_lastal.all.chain
chainPreNet mt_0_lastal.all.chain col.size mt_0.size mt_0_lastal.preNet
chainNet mt_0_lastal.preNet col.size mt_0.size mt_0_lastal.refTarget.net mt_0_lastal.chainNet
netToAxt mt_0_lastal.refTarget.net mt_0_lastal.preNet col.2bit mt_0.2bit stdout | axtSort stdin mt_0_lastal.axt
axtToMaf mt_0_lastal.axt col.size mt_0.size mt_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl mt_0_lastal_final.maf > mt_0_lastal_final_forsplit.maf
cat mt_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > mt_0_lastal_split.maf
cat mt_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > mt_0_lastal_final_split.maf
perl lastToMafComparsion.pl mt_0_lastal_split.maf > mt_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl mt_0_lastal_final_split.maf > mt_0_lastal_final_split_Comparator.maf
lastal col no_0.fa > no_0_lastal.maf
faSize -detailed no_0.fa > no_0.size
faToTwoBit no_0.fa no_0.2bit
maf-convert psl no_0_lastal.maf > no_0_lastal.psl
axtChain -linearGap=loose -psl no_0_lastal.psl -faQ -faT tair10.fa no_0.fa no_0_lastal.chain
chainMergeSort no_0_lastal.chain > no_0_lastal.all.chain
chainPreNet no_0_lastal.all.chain col.size no_0.size no_0_lastal.preNet
chainNet no_0_lastal.preNet col.size no_0.size no_0_lastal.refTarget.net no_0_lastal.chainNet
netToAxt no_0_lastal.refTarget.net no_0_lastal.preNet col.2bit no_0.2bit stdout | axtSort stdin no_0_lastal.axt
axtToMaf no_0_lastal.axt col.size no_0.size no_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl no_0_lastal_final.maf > no_0_lastal_final_forsplit.maf
cat no_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > no_0_lastal_split.maf
cat no_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > no_0_lastal_final_split.maf
perl lastToMafComparsion.pl no_0_lastal_split.maf > no_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl no_0_lastal_final_split.maf > no_0_lastal_final_split_Comparator.maf
lastal col oy_0.fa > oy_0_lastal.maf
faSize -detailed oy_0.fa > oy_0.size
faToTwoBit oy_0.fa oy_0.2bit
maf-convert psl oy_0_lastal.maf > oy_0_lastal.psl
axtChain -linearGap=loose -psl oy_0_lastal.psl -faQ -faT tair10.fa oy_0.fa oy_0_lastal.chain
chainMergeSort oy_0_lastal.chain > oy_0_lastal.all.chain
chainPreNet oy_0_lastal.all.chain col.size oy_0.size oy_0_lastal.preNet
chainNet oy_0_lastal.preNet col.size oy_0.size oy_0_lastal.refTarget.net oy_0_lastal.chainNet
netToAxt oy_0_lastal.refTarget.net oy_0_lastal.preNet col.2bit oy_0.2bit stdout | axtSort stdin oy_0_lastal.axt
axtToMaf oy_0_lastal.axt col.size oy_0.size oy_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl oy_0_lastal_final.maf > oy_0_lastal_final_forsplit.maf
cat oy_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > oy_0_lastal_split.maf
cat oy_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > oy_0_lastal_final_split.maf
perl lastToMafComparsion.pl oy_0_lastal_split.maf > oy_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl oy_0_lastal_final_split.maf > oy_0_lastal_final_split_Comparator.maf
lastal col po_0.fa > po_0_lastal.maf
faSize -detailed po_0.fa > po_0.size
faToTwoBit po_0.fa po_0.2bit
maf-convert psl po_0_lastal.maf > po_0_lastal.psl
axtChain -linearGap=loose -psl po_0_lastal.psl -faQ -faT tair10.fa po_0.fa po_0_lastal.chain
chainMergeSort po_0_lastal.chain > po_0_lastal.all.chain
chainPreNet po_0_lastal.all.chain col.size po_0.size po_0_lastal.preNet
chainNet po_0_lastal.preNet col.size po_0.size po_0_lastal.refTarget.net po_0_lastal.chainNet
netToAxt po_0_lastal.refTarget.net po_0_lastal.preNet col.2bit po_0.2bit stdout | axtSort stdin po_0_lastal.axt
axtToMaf po_0_lastal.axt col.size po_0.size po_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl po_0_lastal_final.maf > po_0_lastal_final_forsplit.maf
cat po_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > po_0_lastal_split.maf
cat po_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > po_0_lastal_final_split.maf
perl lastToMafComparsion.pl po_0_lastal_split.maf > po_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl po_0_lastal_final_split.maf > po_0_lastal_final_split_Comparator.maf
lastal col rsch_4.fa > rsch_4_lastal.maf
faSize -detailed rsch_4.fa > rsch_4.size
faToTwoBit rsch_4.fa rsch_4.2bit
maf-convert psl rsch_4_lastal.maf > rsch_4_lastal.psl
axtChain -linearGap=loose -psl rsch_4_lastal.psl -faQ -faT tair10.fa rsch_4.fa rsch_4_lastal.chain
chainMergeSort rsch_4_lastal.chain > rsch_4_lastal.all.chain
chainPreNet rsch_4_lastal.all.chain col.size rsch_4.size rsch_4_lastal.preNet
chainNet rsch_4_lastal.preNet col.size rsch_4.size rsch_4_lastal.refTarget.net rsch_4_lastal.chainNet
netToAxt rsch_4_lastal.refTarget.net rsch_4_lastal.preNet col.2bit rsch_4.2bit stdout | axtSort stdin rsch_4_lastal.axt
axtToMaf rsch_4_lastal.axt col.size rsch_4.size rsch_4_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl rsch_4_lastal_final.maf > rsch_4_lastal_final_forsplit.maf
cat rsch_4_lastal.maf | last-split | maf-swap | last-split | maf-swap > rsch_4_lastal_split.maf
cat rsch_4_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > rsch_4_lastal_final_split.maf
perl lastToMafComparsion.pl rsch_4_lastal_split.maf > rsch_4_lastal_split_Comparator.maf
perl lastToMafComparsion.pl rsch_4_lastal_final_split.maf > rsch_4_lastal_final_split_Comparator.maf
lastal col sf_2.fa > sf_2_lastal.maf
faSize -detailed sf_2.fa > sf_2.size
faToTwoBit sf_2.fa sf_2.2bit
maf-convert psl sf_2_lastal.maf > sf_2_lastal.psl
axtChain -linearGap=loose -psl sf_2_lastal.psl -faQ -faT tair10.fa sf_2.fa sf_2_lastal.chain
chainMergeSort sf_2_lastal.chain > sf_2_lastal.all.chain
chainPreNet sf_2_lastal.all.chain col.size sf_2.size sf_2_lastal.preNet
chainNet sf_2_lastal.preNet col.size sf_2.size sf_2_lastal.refTarget.net sf_2_lastal.chainNet
netToAxt sf_2_lastal.refTarget.net sf_2_lastal.preNet col.2bit sf_2.2bit stdout | axtSort stdin sf_2_lastal.axt
axtToMaf sf_2_lastal.axt col.size sf_2.size sf_2_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl sf_2_lastal_final.maf > sf_2_lastal_final_forsplit.maf
cat sf_2_lastal.maf | last-split | maf-swap | last-split | maf-swap > sf_2_lastal_split.maf
cat sf_2_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > sf_2_lastal_final_split.maf
perl lastToMafComparsion.pl sf_2_lastal_split.maf > sf_2_lastal_split_Comparator.maf
perl lastToMafComparsion.pl sf_2_lastal_final_split.maf > sf_2_lastal_final_split_Comparator.maf
lastal col tsu_0.fa > tsu_0_lastal.maf
faSize -detailed tsu_0.fa > tsu_0.size
faToTwoBit tsu_0.fa tsu_0.2bit
maf-convert psl tsu_0_lastal.maf > tsu_0_lastal.psl
axtChain -linearGap=loose -psl tsu_0_lastal.psl -faQ -faT tair10.fa tsu_0.fa tsu_0_lastal.chain
chainMergeSort tsu_0_lastal.chain > tsu_0_lastal.all.chain
chainPreNet tsu_0_lastal.all.chain col.size tsu_0.size tsu_0_lastal.preNet
chainNet tsu_0_lastal.preNet col.size tsu_0.size tsu_0_lastal.refTarget.net tsu_0_lastal.chainNet
netToAxt tsu_0_lastal.refTarget.net tsu_0_lastal.preNet col.2bit tsu_0.2bit stdout | axtSort stdin tsu_0_lastal.axt
axtToMaf tsu_0_lastal.axt col.size tsu_0.size tsu_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl tsu_0_lastal_final.maf > tsu_0_lastal_final_forsplit.maf
cat tsu_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > tsu_0_lastal_split.maf
cat tsu_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > tsu_0_lastal_final_split.maf
perl lastToMafComparsion.pl tsu_0_lastal_split.maf > tsu_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl tsu_0_lastal_final_split.maf > tsu_0_lastal_final_split_Comparator.maf
lastal col wil_2.fa > wil_2_lastal.maf
faSize -detailed wil_2.fa > wil_2.size
faToTwoBit wil_2.fa wil_2.2bit
maf-convert psl wil_2_lastal.maf > wil_2_lastal.psl
axtChain -linearGap=loose -psl wil_2_lastal.psl -faQ -faT tair10.fa wil_2.fa wil_2_lastal.chain
chainMergeSort wil_2_lastal.chain > wil_2_lastal.all.chain
chainPreNet wil_2_lastal.all.chain col.size wil_2.size wil_2_lastal.preNet
chainNet wil_2_lastal.preNet col.size wil_2.size wil_2_lastal.refTarget.net wil_2_lastal.chainNet
netToAxt wil_2_lastal.refTarget.net wil_2_lastal.preNet col.2bit wil_2.2bit stdout | axtSort stdin wil_2_lastal.axt
axtToMaf wil_2_lastal.axt col.size wil_2.size wil_2_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl wil_2_lastal_final.maf > wil_2_lastal_final_forsplit.maf
cat wil_2_lastal.maf | last-split | maf-swap | last-split | maf-swap > wil_2_lastal_split.maf
cat wil_2_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > wil_2_lastal_final_split.maf
perl lastToMafComparsion.pl wil_2_lastal_split.maf > wil_2_lastal_split_Comparator.maf
perl lastToMafComparsion.pl wil_2_lastal_final_split.maf > wil_2_lastal_final_split_Comparator.maf
lastal col ws_0.fa > ws_0_lastal.maf
faSize -detailed ws_0.fa > ws_0.size
faToTwoBit ws_0.fa ws_0.2bit
maf-convert psl ws_0_lastal.maf > ws_0_lastal.psl
axtChain -linearGap=loose -psl ws_0_lastal.psl -faQ -faT tair10.fa ws_0.fa ws_0_lastal.chain
chainMergeSort ws_0_lastal.chain > ws_0_lastal.all.chain
chainPreNet ws_0_lastal.all.chain col.size ws_0.size ws_0_lastal.preNet
chainNet ws_0_lastal.preNet col.size ws_0.size ws_0_lastal.refTarget.net ws_0_lastal.chainNet
netToAxt ws_0_lastal.refTarget.net ws_0_lastal.preNet col.2bit ws_0.2bit stdout | axtSort stdin ws_0_lastal.axt
axtToMaf ws_0_lastal.axt col.size ws_0.size ws_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl ws_0_lastal_final.maf > ws_0_lastal_final_forsplit.maf
cat ws_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > ws_0_lastal_split.maf
cat ws_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > ws_0_lastal_final_split.maf
perl lastToMafComparsion.pl ws_0_lastal_split.maf > ws_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl ws_0_lastal_final_split.maf > ws_0_lastal_final_split_Comparator.maf
lastal col wu_0.fa > wu_0_lastal.maf
faSize -detailed wu_0.fa > wu_0.size
faToTwoBit wu_0.fa wu_0.2bit
maf-convert psl wu_0_lastal.maf > wu_0_lastal.psl
axtChain -linearGap=loose -psl wu_0_lastal.psl -faQ -faT tair10.fa wu_0.fa wu_0_lastal.chain
chainMergeSort wu_0_lastal.chain > wu_0_lastal.all.chain
chainPreNet wu_0_lastal.all.chain col.size wu_0.size wu_0_lastal.preNet
chainNet wu_0_lastal.preNet col.size wu_0.size wu_0_lastal.refTarget.net wu_0_lastal.chainNet
netToAxt wu_0_lastal.refTarget.net wu_0_lastal.preNet col.2bit wu_0.2bit stdout | axtSort stdin wu_0_lastal.axt
axtToMaf wu_0_lastal.axt col.size wu_0.size wu_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl wu_0_lastal_final.maf > wu_0_lastal_final_forsplit.maf
cat wu_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > wu_0_lastal_split.maf
cat wu_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > wu_0_lastal_final_split.maf
perl lastToMafComparsion.pl wu_0_lastal_split.maf > wu_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl wu_0_lastal_final_split.maf > wu_0_lastal_final_split_Comparator.maf
lastal col zu_0.fa > zu_0_lastal.maf
faSize -detailed zu_0.fa > zu_0.size
faToTwoBit zu_0.fa zu_0.2bit
maf-convert psl zu_0_lastal.maf > zu_0_lastal.psl
axtChain -linearGap=loose -psl zu_0_lastal.psl -faQ -faT tair10.fa zu_0.fa zu_0_lastal.chain
chainMergeSort zu_0_lastal.chain > zu_0_lastal.all.chain
chainPreNet zu_0_lastal.all.chain col.size zu_0.size zu_0_lastal.preNet
chainNet zu_0_lastal.preNet col.size zu_0.size zu_0_lastal.refTarget.net zu_0_lastal.chainNet
netToAxt zu_0_lastal.refTarget.net zu_0_lastal.preNet col.2bit zu_0.2bit stdout | axtSort stdin zu_0_lastal.axt
axtToMaf zu_0_lastal.axt col.size zu_0.size zu_0_lastal_final.maf -qPrefix=query. -tPrefix=col.
perl lastFinalToSplit.pl zu_0_lastal_final.maf > zu_0_lastal_final_forsplit.maf
cat zu_0_lastal.maf | last-split | maf-swap | last-split | maf-swap > zu_0_lastal_split.maf
cat zu_0_lastal_final_forsplit.maf | last-split | maf-swap | last-split | maf-swap > zu_0_lastal_final_split.maf
perl lastToMafComparsion.pl zu_0_lastal_split.maf > zu_0_lastal_split_Comparator.maf
perl lastToMafComparsion.pl zu_0_lastal_final_split.maf > zu_0_lastal_final_split_Comparator.maf
/usr/bin/time -v bash last_bur_0.sh > last_bur_0.log 2>&1
/usr/bin/time -v bash last_can_0.sh > last_can_0.log 2>&1
/usr/bin/time -v bash last_ct_1.sh > last_ct_1.log 2>&1
/usr/bin/time -v bash last_edi_0.sh > last_edi_0.log 2>&1
/usr/bin/time -v bash last_hi_0.sh > last_hi_0.log 2>&1
/usr/bin/time -v bash last_kn_0.sh > last_kn_0.log 2>&1
/usr/bin/time -v bash last_ler_0.sh > last_ler_0.log 2>&1
/usr/bin/time -v bash last_mt_0.sh > last_mt_0.log 2>&1
/usr/bin/time -v bash last_no_0.sh > last_no_0.log 2>&1
/usr/bin/time -v bash last_oy_0.sh > last_oy_0.log 2>&1
/usr/bin/time -v bash last_po_0.sh > last_po_0.log 2>&1
/usr/bin/time -v bash last_rsch_4.sh > last_rsch_4.log 2>&1
/usr/bin/time -v bash last_sf_2.sh > last_sf_2.log 2>&1
/usr/bin/time -v bash last_tsu_0.sh > last_tsu_0.log 2>&1
/usr/bin/time -v bash last_wil_2.sh > last_wil_2.log 2>&1
/usr/bin/time -v bash last_ws_0.sh > last_ws_0.log 2>&1
/usr/bin/time -v bash last_wu_0.sh > last_wu_0.log 2>&1
/usr/bin/time -v bash last_zu_0.sh > last_zu_0.log 2>&1
Evaluate LAST one-to-one alignments
python3 CompareMafAndCheckMafCoverage.py col_bur.maf bur_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_can.maf can_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_ct.maf ct_1_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_edi.maf edi_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_hi.maf hi_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_kn.maf kn_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_ler.maf ler_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_mt.maf mt_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_no.maf no_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_oy.maf oy_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_po.maf po_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_rsch.maf rsch_4_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_sf.maf sf_2_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_tsu.maf tsu_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_wil.maf wil_2_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_ws.maf ws_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_wu.maf wu_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_zu.maf zu_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_bur.maf bur_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_can.maf can_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_ct.maf ct_1_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_edi.maf edi_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_hi.maf hi_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_kn.maf kn_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_ler.maf ler_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_mt.maf mt_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_no.maf no_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_oy.maf oy_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_po.maf po_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_rsch.maf rsch_4_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_sf.maf sf_2_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_tsu.maf tsu_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_wil.maf wil_2_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_ws.maf ws_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_wu.maf wu_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverage.py col_zu.maf zu_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_bur.maf bur_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_can.maf can_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ct.maf ct_1_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_edi.maf edi_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_hi.maf hi_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_kn.maf kn_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ler.maf ler_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_mt.maf mt_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_no.maf no_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_oy.maf oy_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_po.maf po_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_rsch.maf rsch_4_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_sf.maf sf_2_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_tsu.maf tsu_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wil.maf wil_2_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ws.maf ws_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wu.maf wu_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_zu.maf zu_0_lastal_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_bur.maf bur_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_can.maf can_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ct.maf ct_1_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_edi.maf edi_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_hi.maf hi_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_kn.maf kn_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ler.maf ler_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_mt.maf mt_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_no.maf no_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_oy.maf oy_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_po.maf po_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_rsch.maf rsch_4_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_sf.maf sf_2_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_tsu.maf tsu_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wil.maf wil_2_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ws.maf ws_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wu.maf wu_0_lastal_final_split_Comparator.maf
python3 CompareMafAndCheckMafCoverageAll.py col_zu.maf zu_0_lastal_final_split_Comparator.maf
Perform genome alignment using MUMmer4 Vrc1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.bur_0.short.sam tair10.fa bur_0.fa > nucmer_bur_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.can_0.short.sam tair10.fa can_0.fa > nucmer_can_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.ct_1.short.sam tair10.fa ct_1.fa > nucmer_ct_1.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.edi_0.short.sam tair10.fa edi_0.fa > nucmer_edi_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.hi_0.short.sam tair10.fa hi_0.fa > nucmer_hi_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.kn_0.short.sam tair10.fa kn_0.fa > nucmer_kn_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.ler_0.short.sam tair10.fa ler_0.fa > nucmer_ler_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.mt_0.short.sam tair10.fa mt_0.fa > nucmer_mt_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.no_0.short.sam tair10.fa no_0.fa > nucmer_no_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.oy_0.short.sam tair10.fa oy_0.fa > nucmer_oy_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.po_0.short.sam tair10.fa po_0.fa > nucmer_po_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.rsch_4.short.sam tair10.fa rsch_4.fa > nucmer_rsch_4.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.sf_2.short.sam tair10.fa sf_2.fa > nucmer_sf_2.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.tsu_0.short.sam tair10.fa tsu_0.fa > nucmer_tsu_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.wil_2.short.sam tair10.fa wil_2.fa > nucmer_wil_2.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.ws_0.short.sam tair10.fa ws_0.fa > nucmer_ws_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.wu_0.short.sam tair10.fa wu_0.fa > nucmer_wu_0.log 2>&1
/usr/bin/time /home/bs674/software/bin/nucmer -t 1 --sam-short=mumer.zu_0.short.sam tair10.fa zu_0.fa > nucmer_zu_0.log 2>&1
Reformat MUMmer4 SAM format output into MAF format
anchorwave sam2maf -r tair10.fa -q bur_0.fa -s mumer.bur_0.short.sam -o mumer.bur_0.short.maf
anchorwave sam2maf -r tair10.fa -q can_0.fa -s mumer.can_0.short.sam -o mumer.can_0.short.maf
anchorwave sam2maf -r tair10.fa -q ct_1.fa -s mumer.ct_1.short.sam -o mumer.ct_1.short.maf
anchorwave sam2maf -r tair10.fa -q edi_0.fa -s mumer.edi_0.short.sam -o mumer.edi_0.short.maf
anchorwave sam2maf -r tair10.fa -q hi_0.fa -s mumer.hi_0.short.sam -o mumer.hi_0.short.maf
anchorwave sam2maf -r tair10.fa -q kn_0.fa -s mumer.kn_0.short.sam -o mumer.kn_0.short.maf
anchorwave sam2maf -r tair10.fa -q ler_0.fa -s mumer.ler_0.short.sam -o mumer.ler_0.short.maf
anchorwave sam2maf -r tair10.fa -q mt_0.fa -s mumer.mt_0.short.sam -o mumer.mt_0.short.maf
anchorwave sam2maf -r tair10.fa -q no_0.fa -s mumer.no_0.short.sam -o mumer.no_0.short.maf
anchorwave sam2maf -r tair10.fa -q oy_0.fa -s mumer.oy_0.short.sam -o mumer.oy_0.short.maf
anchorwave sam2maf -r tair10.fa -q po_0.fa -s mumer.po_0.short.sam -o mumer.po_0.short.maf
anchorwave sam2maf -r tair10.fa -q rsch_4.fa -s mumer.rsch_4.short.sam -o mumer.rsch_4.short.maf
anchorwave sam2maf -r tair10.fa -q sf_2.fa -s mumer.sf_2.short.sam -o mumer.sf_2.short.maf
anchorwave sam2maf -r tair10.fa -q tsu_0.fa -s mumer.tsu_0.short.sam -o mumer.tsu_0.short.maf
anchorwave sam2maf -r tair10.fa -q wil_2.fa -s mumer.wil_2.short.sam -o mumer.wil_2.short.maf
anchorwave sam2maf -r tair10.fa -q ws_0.fa -s mumer.ws_0.short.sam -o mumer.ws_0.short.maf
anchorwave sam2maf -r tair10.fa -q wu_0.fa -s mumer.wu_0.short.sam -o mumer.wu_0.short.maf
anchorwave sam2maf -r tair10.fa -q zu_0.fa -s mumer.zu_0.short.sam -o mumer.zu_0.short.maf
Evaluate the performance of MUMmer4
python3 CompareMafAndCheckMafCoverage.py col_bur.maf mumer.bur_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_can.maf mumer.can_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_ct.maf mumer.ct_1.short.maf
python3 CompareMafAndCheckMafCoverage.py col_edi.maf mumer.edi_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_hi.maf mumer.hi_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_kn.maf mumer.kn_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_ler.maf mumer.ler_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_mt.maf mumer.mt_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_no.maf mumer.no_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_oy.maf mumer.oy_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_po.maf mumer.po_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_rsch.maf mumer.rsch_4.short.maf
python3 CompareMafAndCheckMafCoverage.py col_sf.maf mumer.sf_2.short.maf
python3 CompareMafAndCheckMafCoverage.py col_tsu.maf mumer.tsu_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_wil.maf mumer.wil_2.short.maf
python3 CompareMafAndCheckMafCoverage.py col_ws.maf mumer.ws_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_wu.maf mumer.wu_0.short.maf
python3 CompareMafAndCheckMafCoverage.py col_zu.maf mumer.zu_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_bur.maf mumer.bur_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_can.maf mumer.can_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ct.maf mumer.ct_1.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_edi.maf mumer.edi_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_hi.maf mumer.hi_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_kn.maf mumer.kn_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ler.maf mumer.ler_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_mt.maf mumer.mt_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_no.maf mumer.no_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_oy.maf mumer.oy_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_po.maf mumer.po_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_rsch.maf mumer.rsch_4.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_sf.maf mumer.sf_2.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_tsu.maf mumer.tsu_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wil.maf mumer.wil_2.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ws.maf mumer.ws_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wu.maf mumer.wu_0.short.maf
python3 CompareMafAndCheckMafCoverageAll.py col_zu.maf mumer.zu_0.short.maf
Perform genome alignment using GSAlign
/usr/bin/time GSAlign -r tair10.fa -q bur_0.fa -t 1 -o bur_0_gsalign -fmt 1 > GSAlign_bur_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q can_0.fa -t 1 -o can_0_gsalign -fmt 1 > GSAlign_can_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q ct_1.fa -t 1 -o ct_1_gsalign -fmt 1 > GSAlign_ct_1.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q edi_0.fa -t 1 -o edi_0_gsalign -fmt 1 > GSAlign_edi_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q hi_0.fa -t 1 -o hi_0_gsalign -fmt 1 > GSAlign_hi_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q kn_0.fa -t 1 -o kn_0_gsalign -fmt 1 > GSAlign_kn_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q ler_0.fa -t 1 -o ler_0_gsalign -fmt 1 > GSAlign_ler_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q mt_0.fa -t 1 -o mt_0_gsalign -fmt 1 > GSAlign_mt_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q no_0.fa -t 1 -o no_0_gsalign -fmt 1 > GSAlign_no_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q oy_0.fa -t 1 -o oy_0_gsalign -fmt 1 > GSAlign_oy_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q po_0.fa -t 1 -o po_0_gsalign -fmt 1 > GSAlign_po_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q rsch_4.fa -t 1 -o rsch_4_gsalign -fmt 1 > GSAlign_rsch_4.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q sf_2.fa -t 1 -o sf_2_gsalign -fmt 1 > GSAlign_sf_2.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q tsu_0.fa -t 1 -o tsu_0_gsalign -fmt 1 > GSAlign_tsu_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q wil_2.fa -t 1 -o wil_2_gsalign -fmt 1 > GSAlign_wil_2.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q ws_0.fa -t 1 -o ws_0_gsalign -fmt 1 > GSAlign_ws_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q wu_0.fa -t 1 -o wu_0_gsalign -fmt 1 > GSAlign_wu_0.log 2>&1
/usr/bin/time GSAlign -r tair10.fa -q zu_0.fa -t 1 -o zu_0_gsalign -fmt 1 > GSAlign_zu_0.log 2>&1
sed -i 's/ref./col./g' *gsalign.maf
sed -i 's/qry./query./g' *gsalign.maf
cat bur_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > bur_0_gsalign_temp.maf
cat can_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > can_0_gsalign_temp.maf
cat ct_1_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > ct_1_gsalign_temp.maf
cat edi_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > edi_0_gsalign_temp.maf
cat hi_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > hi_0_gsalign_temp.maf
cat kn_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > kn_0_gsalign_temp.maf
cat ler_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > ler_0_gsalign_temp.maf
cat mt_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > mt_0_gsalign_temp.maf
cat no_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > no_0_gsalign_temp.maf
cat oy_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > oy_0_gsalign_temp.maf
cat po_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > po_0_gsalign_temp.maf
cat rsch_4_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > rsch_4_gsalign_temp.maf
cat sf_2_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > sf_2_gsalign_temp.maf
cat tsu_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > tsu_0_gsalign_temp.maf
cat wil_2_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > wil_2_gsalign_temp.maf
cat ws_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > ws_0_gsalign_temp.maf
cat wu_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > wu_0_gsalign_temp.maf
cat zu_0_gsalign.maf | awk 'length($7) == prev { print prevline"\n"$0 } { prev = length($7); prevline=$0 }' > zu_0_gsalign_temp.maf
sed -i '1d' bur_0_gsalign_temp.maf
sed -i '1d' bur_0_gsalign_temp.maf
sed -i '1d' can_0_gsalign_temp.maf
sed -i '1d' can_0_gsalign_temp.maf
sed -i '1d' ct_1_gsalign_temp.maf
sed -i '1d' ct_1_gsalign_temp.maf
sed -i '1d' edi_0_gsalign_temp.maf
sed -i '1d' edi_0_gsalign_temp.maf
sed -i '1d' hi_0_gsalign_temp.maf
sed -i '1d' hi_0_gsalign_temp.maf
sed -i '1d' kn_0_gsalign_temp.maf
sed -i '1d' kn_0_gsalign_temp.maf
sed -i '1d' ler_0_gsalign_temp.maf
sed -i '1d' ler_0_gsalign_temp.maf
sed -i '1d' mt_0_gsalign_temp.maf
sed -i '1d' mt_0_gsalign_temp.maf
sed -i '1d' no_0_gsalign_temp.maf
sed -i '1d' no_0_gsalign_temp.maf
sed -i '1d' oy_0_gsalign_temp.maf
sed -i '1d' oy_0_gsalign_temp.maf
sed -i '1d' po_0_gsalign_temp.maf
sed -i '1d' po_0_gsalign_temp.maf
sed -i '1d' rsch_4_gsalign_temp.maf
sed -i '1d' rsch_4_gsalign_temp.maf
sed -i '1d' sf_2_gsalign_temp.maf
sed -i '1d' sf_2_gsalign_temp.maf
sed -i '1d' tsu_0_gsalign_temp.maf
sed -i '1d' tsu_0_gsalign_temp.maf
sed -i '1d' wil_2_gsalign_temp.maf
sed -i '1d' wil_2_gsalign_temp.maf
sed -i '1d' ws_0_gsalign_temp.maf
sed -i '1d' ws_0_gsalign_temp.maf
sed -i '1d' wu_0_gsalign_temp.maf
sed -i '1d' wu_0_gsalign_temp.maf
sed -i '1d' zu_0_gsalign_temp.maf
sed -i '1d' zu_0_gsalign_temp.maf
Evaluate the performance of GSAlign
python3 CompareMafAndCheckMafCoverage.py col_bur.maf bur_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_can.maf can_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_ct.maf ct_1_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_edi.maf edi_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_hi.maf hi_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_kn.maf kn_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_ler.maf ler_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_mt.maf mt_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_no.maf no_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_oy.maf oy_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_po.maf po_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_rsch.maf rsch_4_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_sf.maf sf_2_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_tsu.maf tsu_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_wil.maf wil_2_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_ws.maf ws_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_wu.maf wu_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverage.py col_zu.maf zu_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_bur.maf bur_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_can.maf can_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ct.maf ct_1_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_edi.maf edi_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_hi.maf hi_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_kn.maf kn_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ler.maf ler_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_mt.maf mt_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_no.maf no_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_oy.maf oy_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_po.maf po_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_rsch.maf rsch_4_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_sf.maf sf_2_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_tsu.maf tsu_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wil.maf wil_2_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_ws.maf ws_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_wu.maf wu_0_gsalign_temp.maf
python3 CompareMafAndCheckMafCoverageAll.py col_zu.maf zu_0_gsalign_temp.maf
Organize the result into a single summary file named as summaryTable
cat bur_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tbur_0\t"$0}' > summaryTable
cat can_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tcan_0\t"$0}' >> summaryTable
cat ct_1.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tct_1\t"$0}' >> summaryTable
cat edi_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tedi_0\t"$0}' >> summaryTable
cat hi_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\thi_0\t"$0}' >> summaryTable
cat kn_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tkn_0\t"$0}' >> summaryTable
cat ler_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tler_0\t"$0}' >> summaryTable
cat mt_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tmt_0\t"$0}' >> summaryTable
cat no_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tno_0\t"$0}' >> summaryTable
cat oy_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\toy_0\t"$0}' >> summaryTable
cat po_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tpo_0\t"$0}' >> summaryTable
cat rsch_4.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\trsch_4\t"$0}' >> summaryTable
cat sf_2.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tsf_2\t"$0}' >> summaryTable
cat tsu_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\ttsu_0\t"$0}' >> summaryTable
cat wil_2.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\twil_2\t"$0}' >> summaryTable
cat ws_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tws_0\t"$0}' >> summaryTable
cat wu_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\twu_0\t"$0}' >> summaryTable
cat zu_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tzu_0\t"$0}' >> summaryTable
cat minimap2_asm5_bur_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tbur_0\t"$0}' >> summaryTable
cat minimap2_asm5_can_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tcan_0\t"$0}' >> summaryTable
cat minimap2_asm5_ct_1.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tct_1\t"$0}' >> summaryTable
cat minimap2_asm5_edi_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tedi_0\t"$0}' >> summaryTable
cat minimap2_asm5_hi_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\thi_0\t"$0}' >> summaryTable
cat minimap2_asm5_kn_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tkn_0\t"$0}' >> summaryTable
cat minimap2_asm5_ler_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tler_0\t"$0}' >> summaryTable
cat minimap2_asm5_mt_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tmt_0\t"$0}' >> summaryTable
cat minimap2_asm5_no_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tno_0\t"$0}' >> summaryTable
cat minimap2_asm5_oy_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\toy_0\t"$0}' >> summaryTable
cat minimap2_asm5_po_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tpo_0\t"$0}' >> summaryTable
cat minimap2_asm5_rsch_4.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\trsch_4\t"$0}' >> summaryTable
cat minimap2_asm5_sf_2.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tsf_2\t"$0}' >> summaryTable
cat minimap2_asm5_tsu_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\ttsu_0\t"$0}' >> summaryTable
cat minimap2_asm5_wil_2.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\twil_2\t"$0}' >> summaryTable
cat minimap2_asm5_ws_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tws_0\t"$0}' >> summaryTable
cat minimap2_asm5_wu_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\twu_0\t"$0}' >> summaryTable
cat minimap2_asm5_zu_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tzu_0\t"$0}' >> summaryTable
cat minimap2_asm10_bur_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tbur_0\t"$0}' >> summaryTable
cat minimap2_asm10_can_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tcan_0\t"$0}' >> summaryTable
cat minimap2_asm10_ct_1.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tct_1\t"$0}' >> summaryTable
cat minimap2_asm10_edi_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tedi_0\t"$0}' >> summaryTable
cat minimap2_asm10_hi_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\thi_0\t"$0}' >> summaryTable
cat minimap2_asm10_kn_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tkn_0\t"$0}' >> summaryTable
cat minimap2_asm10_ler_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tler_0\t"$0}' >> summaryTable
cat minimap2_asm10_mt_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tmt_0\t"$0}' >> summaryTable
cat minimap2_asm10_no_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tno_0\t"$0}' >> summaryTable
cat minimap2_asm10_oy_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\toy_0\t"$0}' >> summaryTable
cat minimap2_asm10_po_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tpo_0\t"$0}' >> summaryTable
cat minimap2_asm10_rsch_4.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\trsch_4\t"$0}' >> summaryTable
cat minimap2_asm10_sf_2.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tsf_2\t"$0}' >> summaryTable
cat minimap2_asm10_tsu_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\ttsu_0\t"$0}' >> summaryTable
cat minimap2_asm10_wil_2.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\twil_2\t"$0}' >> summaryTable
cat minimap2_asm10_ws_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tws_0\t"$0}' >> summaryTable
cat minimap2_asm10_wu_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\twu_0\t"$0}' >> summaryTable
cat minimap2_asm10_zu_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tzu_0\t"$0}' >> summaryTable
cat minimap2_asm20_bur_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tbur_0\t"$0}' >> summaryTable
cat minimap2_asm20_can_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tcan_0\t"$0}' >> summaryTable
cat minimap2_asm20_ct_1.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tct_1\t"$0}' >> summaryTable
cat minimap2_asm20_edi_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tedi_0\t"$0}' >> summaryTable
cat minimap2_asm20_hi_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\thi_0\t"$0}' >> summaryTable
cat minimap2_asm20_kn_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tkn_0\t"$0}' >> summaryTable
cat minimap2_asm20_ler_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tler_0\t"$0}' >> summaryTable
cat minimap2_asm20_mt_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tmt_0\t"$0}' >> summaryTable
cat minimap2_asm20_no_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tno_0\t"$0}' >> summaryTable
cat minimap2_asm20_oy_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\toy_0\t"$0}' >> summaryTable
cat minimap2_asm20_po_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tpo_0\t"$0}' >> summaryTable
cat minimap2_asm20_rsch_4.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\trsch_4\t"$0}' >> summaryTable
cat minimap2_asm20_sf_2.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tsf_2\t"$0}' >> summaryTable
cat minimap2_asm20_tsu_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\ttsu_0\t"$0}' >> summaryTable
cat minimap2_asm20_wil_2.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\twil_2\t"$0}' >> summaryTable
cat minimap2_asm20_ws_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tws_0\t"$0}' >> summaryTable
cat minimap2_asm20_wu_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\twu_0\t"$0}' >> summaryTable
cat minimap2_asm20_zu_0.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tzu_0\t"$0}' >> summaryTable
cat mumer.bur_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tbur_0\t"$0}' >> summaryTable
cat mumer.can_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tcan_0\t"$0}' >> summaryTable
cat mumer.ct_1.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tct_1\t"$0}' >> summaryTable
cat mumer.edi_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tedi_0\t"$0}' >> summaryTable
cat mumer.hi_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\thi_0\t"$0}' >> summaryTable
cat mumer.kn_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tkn_0\t"$0}' >> summaryTable
cat mumer.ler_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tler_0\t"$0}' >> summaryTable
cat mumer.mt_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tmt_0\t"$0}' >> summaryTable
cat mumer.no_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tno_0\t"$0}' >> summaryTable
cat mumer.oy_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\toy_0\t"$0}' >> summaryTable
cat mumer.po_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tpo_0\t"$0}' >> summaryTable
cat mumer.rsch_4.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\trsch_4\t"$0}' >> summaryTable
cat mumer.sf_2.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tsf_2\t"$0}' >> summaryTable
cat mumer.tsu_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\ttsu_0\t"$0}' >> summaryTable
cat mumer.wil_2.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\twil_2\t"$0}' >> summaryTable
cat mumer.ws_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tws_0\t"$0}' >> summaryTable
cat mumer.wu_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\twu_0\t"$0}' >> summaryTable
cat mumer.zu_0.short.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tzu_0\t"$0}' >> summaryTable
cat bur_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tbur_0\t"$0}' >> summaryTable
cat can_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tcan_0\t"$0}' >> summaryTable
cat ct_1_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tct_1\t"$0}' >> summaryTable
cat edi_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tedi_0\t"$0}' >> summaryTable
cat hi_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\thi_0\t"$0}' >> summaryTable
cat kn_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tkn_0\t"$0}' >> summaryTable
cat ler_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tler_0\t"$0}' >> summaryTable
cat mt_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tmt_0\t"$0}' >> summaryTable
cat no_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tno_0\t"$0}' >> summaryTable
cat oy_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\toy_0\t"$0}' >> summaryTable
cat po_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tpo_0\t"$0}' >> summaryTable
cat rsch_4_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\trsch_4\t"$0}' >> summaryTable
cat sf_2_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tsf_2\t"$0}' >> summaryTable
cat tsu_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\ttsu_0\t"$0}' >> summaryTable
cat wil_2_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\twil_2\t"$0}' >> summaryTable
cat ws_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tws_0\t"$0}' >> summaryTable
cat wu_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\twu_0\t"$0}' >> summaryTable
cat zu_0_gsalign_temp.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tzu_0\t"$0}' >> summaryTable
cat bur_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tbur_0\t"$0}' >> summaryTable
cat can_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tcan_0\t"$0}' >> summaryTable
cat ct_1_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tct_1\t"$0}' >> summaryTable
cat edi_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tedi_0\t"$0}' >> summaryTable
cat hi_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\thi_0\t"$0}' >> summaryTable
cat kn_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tkn_0\t"$0}' >> summaryTable
cat ler_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tler_0\t"$0}' >> summaryTable
cat mt_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tmt_0\t"$0}' >> summaryTable
cat no_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tno_0\t"$0}' >> summaryTable
cat oy_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\toy_0\t"$0}' >> summaryTable
cat po_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tpo_0\t"$0}' >> summaryTable
cat rsch_4_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\trsch_4\t"$0}' >> summaryTable
cat sf_2_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tsf_2\t"$0}' >> summaryTable
cat tsu_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\ttsu_0\t"$0}' >> summaryTable
cat wil_2_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\twil_2\t"$0}' >> summaryTable
cat ws_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tws_0\t"$0}' >> summaryTable
cat wu_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\twu_0\t"$0}' >> summaryTable
cat zu_0_lastal_final_split_Comparator.maf.aliEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tzu_0\t"$0}' >> summaryTable
cat bur_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tbur_0\t"$0}' > allSummaryTable
cat can_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tcan_0\t"$0}' >> allSummaryTable
cat ct_1.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tct_1\t"$0}' >> allSummaryTable
cat edi_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tedi_0\t"$0}' >> allSummaryTable
cat hi_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\thi_0\t"$0}' >> allSummaryTable
cat kn_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tkn_0\t"$0}' >> allSummaryTable
cat ler_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tler_0\t"$0}' >> allSummaryTable
cat mt_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tmt_0\t"$0}' >> allSummaryTable
cat no_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tno_0\t"$0}' >> allSummaryTable
cat oy_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\toy_0\t"$0}' >> allSummaryTable
cat po_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tpo_0\t"$0}' >> allSummaryTable
cat rsch_4.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\trsch_4\t"$0}' >> allSummaryTable
cat sf_2.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tsf_2\t"$0}' >> allSummaryTable
cat tsu_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\ttsu_0\t"$0}' >> allSummaryTable
cat wil_2.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\twil_2\t"$0}' >> allSummaryTable
cat ws_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tws_0\t"$0}' >> allSummaryTable
cat wu_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\twu_0\t"$0}' >> allSummaryTable
cat zu_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "AnchorWave\tAnchorWave\tzu_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_bur_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tbur_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_can_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tcan_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_ct_1.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tct_1\t"$0}' >> allSummaryTable
cat minimap2_asm5_edi_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tedi_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_hi_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\thi_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_kn_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tkn_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_ler_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tler_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_mt_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tmt_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_no_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tno_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_oy_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\toy_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_po_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tpo_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_rsch_4.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\trsch_4\t"$0}' >> allSummaryTable
cat minimap2_asm5_sf_2.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tsf_2\t"$0}' >> allSummaryTable
cat minimap2_asm5_tsu_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\ttsu_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_wil_2.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\twil_2\t"$0}' >> allSummaryTable
cat minimap2_asm5_ws_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tws_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_wu_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\twu_0\t"$0}' >> allSummaryTable
cat minimap2_asm5_zu_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm5\tzu_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_bur_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tbur_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_can_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tcan_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_ct_1.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tct_1\t"$0}' >> allSummaryTable
cat minimap2_asm10_edi_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tedi_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_hi_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\thi_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_kn_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tkn_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_ler_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tler_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_mt_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tmt_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_no_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tno_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_oy_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\toy_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_po_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tpo_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_rsch_4.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\trsch_4\t"$0}' >> allSummaryTable
cat minimap2_asm10_sf_2.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tsf_2\t"$0}' >> allSummaryTable
cat minimap2_asm10_tsu_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\ttsu_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_wil_2.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\twil_2\t"$0}' >> allSummaryTable
cat minimap2_asm10_ws_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tws_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_wu_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\twu_0\t"$0}' >> allSummaryTable
cat minimap2_asm10_zu_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm10\tzu_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_bur_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tbur_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_can_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tcan_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_ct_1.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tct_1\t"$0}' >> allSummaryTable
cat minimap2_asm20_edi_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tedi_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_hi_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\thi_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_kn_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tkn_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_ler_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tler_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_mt_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tmt_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_no_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tno_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_oy_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\toy_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_po_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tpo_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_rsch_4.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\trsch_4\t"$0}' >> allSummaryTable
cat minimap2_asm20_sf_2.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tsf_2\t"$0}' >> allSummaryTable
cat minimap2_asm20_tsu_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\ttsu_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_wil_2.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\twil_2\t"$0}' >> allSummaryTable
cat minimap2_asm20_ws_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tws_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_wu_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\twu_0\t"$0}' >> allSummaryTable
cat minimap2_asm20_zu_0.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "minimap2\tminimap2_asm20\tzu_0\t"$0}' >> allSummaryTable
cat mumer.bur_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tbur_0\t"$0}' >> allSummaryTable
cat mumer.can_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tcan_0\t"$0}' >> allSummaryTable
cat mumer.ct_1.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tct_1\t"$0}' >> allSummaryTable
cat mumer.edi_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tedi_0\t"$0}' >> allSummaryTable
cat mumer.hi_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\thi_0\t"$0}' >> allSummaryTable
cat mumer.kn_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tkn_0\t"$0}' >> allSummaryTable
cat mumer.ler_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tler_0\t"$0}' >> allSummaryTable
cat mumer.mt_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tmt_0\t"$0}' >> allSummaryTable
cat mumer.no_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tno_0\t"$0}' >> allSummaryTable
cat mumer.oy_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\toy_0\t"$0}' >> allSummaryTable
cat mumer.po_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tpo_0\t"$0}' >> allSummaryTable
cat mumer.rsch_4.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\trsch_4\t"$0}' >> allSummaryTable
cat mumer.sf_2.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tsf_2\t"$0}' >> allSummaryTable
cat mumer.tsu_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\ttsu_0\t"$0}' >> allSummaryTable
cat mumer.wil_2.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\twil_2\t"$0}' >> allSummaryTable
cat mumer.ws_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tws_0\t"$0}' >> allSummaryTable
cat mumer.wu_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\twu_0\t"$0}' >> allSummaryTable
cat mumer.zu_0.short.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "MUMmer4\tMUMmer4\tzu_0\t"$0}' >> allSummaryTable
cat bur_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tbur_0\t"$0}' >> allSummaryTable
cat can_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tcan_0\t"$0}' >> allSummaryTable
cat ct_1_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tct_1\t"$0}' >> allSummaryTable
cat edi_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tedi_0\t"$0}' >> allSummaryTable
cat hi_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\thi_0\t"$0}' >> allSummaryTable
cat kn_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tkn_0\t"$0}' >> allSummaryTable
cat ler_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tler_0\t"$0}' >> allSummaryTable
cat mt_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tmt_0\t"$0}' >> allSummaryTable
cat no_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tno_0\t"$0}' >> allSummaryTable
cat oy_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\toy_0\t"$0}' >> allSummaryTable
cat po_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tpo_0\t"$0}' >> allSummaryTable
cat rsch_4_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\trsch_4\t"$0}' >> allSummaryTable
cat sf_2_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tsf_2\t"$0}' >> allSummaryTable
cat tsu_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\ttsu_0\t"$0}' >> allSummaryTable
cat wil_2_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\twil_2\t"$0}' >> allSummaryTable
cat ws_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tws_0\t"$0}' >> allSummaryTable
cat wu_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\twu_0\t"$0}' >> allSummaryTable
cat zu_0_gsalign_temp.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "GSAlign\tGSAlign\tzu_0\t"$0}' >> allSummaryTable
cat bur_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tbur_0\t"$0}' >> allSummaryTable
cat can_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tcan_0\t"$0}' >> allSummaryTable
cat ct_1_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tct_1\t"$0}' >> allSummaryTable
cat edi_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tedi_0\t"$0}' >> allSummaryTable
cat hi_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\thi_0\t"$0}' >> allSummaryTable
cat kn_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tkn_0\t"$0}' >> allSummaryTable
cat ler_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tler_0\t"$0}' >> allSummaryTable
cat mt_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tmt_0\t"$0}' >> allSummaryTable
cat no_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tno_0\t"$0}' >> allSummaryTable
cat oy_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\toy_0\t"$0}' >> allSummaryTable
cat po_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tpo_0\t"$0}' >> allSummaryTable
cat rsch_4_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\trsch_4\t"$0}' >> allSummaryTable
cat sf_2_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tsf_2\t"$0}' >> allSummaryTable
cat tsu_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\ttsu_0\t"$0}' >> allSummaryTable
cat wil_2_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\twil_2\t"$0}' >> allSummaryTable
cat ws_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tws_0\t"$0}' >> allSummaryTable
cat wu_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\twu_0\t"$0}' >> allSummaryTable
cat zu_0_lastal_final_split_Comparator.maf.aliAllEvaluatioin | grep "recall\|precision\|fscore" | sed ':a;N;$!ba;s/\n//g' | sed 's/recall://g' | sed 's/precision:/\t/g' | sed 's/fscore:/\t/g' | awk '{print "LAST\tLAST+one-to-one\tzu_0\t"$0}' >> allSummaryTable
Check the proportion of genome being covered
maf-convert sam bur_0.maf > bur_0_AnchorWave.sam ; sed -i 's/query.//g' bur_0_AnchorWave.sam; sed -i 's/col.//g' bur_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa bur_0_AnchorWave.sam | samtools sort - > bur_0_AnchorWave.bam; samtools index bur_0_AnchorWave.bam ; samtools depth bur_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\tbur_0\t"$0}' > depth
maf-convert sam can_0.maf > can_0_AnchorWave.sam ; sed -i 's/query.//g' can_0_AnchorWave.sam; sed -i 's/col.//g' can_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa can_0_AnchorWave.sam | samtools sort - > can_0_AnchorWave.bam; samtools index can_0_AnchorWave.bam ; samtools depth can_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\tcan_0\t"$0}' >> depth
maf-convert sam ct_1.maf > ct_1_AnchorWave.sam ; sed -i 's/query.//g' ct_1_AnchorWave.sam; sed -i 's/col.//g' ct_1_AnchorWave.sam; samtools view -O BAM --reference tair10.fa ct_1_AnchorWave.sam | samtools sort - > ct_1_AnchorWave.bam; samtools index ct_1_AnchorWave.bam ; samtools depth ct_1_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\tct_1\t"$0}' >> depth
maf-convert sam edi_0.maf > edi_0_AnchorWave.sam ; sed -i 's/query.//g' edi_0_AnchorWave.sam; sed -i 's/col.//g' edi_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa edi_0_AnchorWave.sam | samtools sort - > edi_0_AnchorWave.bam; samtools index edi_0_AnchorWave.bam ; samtools depth edi_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\tedi_0\t"$0}' >> depth
maf-convert sam hi_0.maf > hi_0_AnchorWave.sam ; sed -i 's/query.//g' hi_0_AnchorWave.sam; sed -i 's/col.//g' hi_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa hi_0_AnchorWave.sam | samtools sort - > hi_0_AnchorWave.bam; samtools index hi_0_AnchorWave.bam ; samtools depth hi_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\thi_0\t"$0}' >> depth
maf-convert sam kn_0.maf > kn_0_AnchorWave.sam ; sed -i 's/query.//g' kn_0_AnchorWave.sam; sed -i 's/col.//g' kn_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa kn_0_AnchorWave.sam | samtools sort - > kn_0_AnchorWave.bam; samtools index kn_0_AnchorWave.bam ; samtools depth kn_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\tkn_0\t"$0}' >> depth
maf-convert sam ler_0.maf > ler_0_AnchorWave.sam ; sed -i 's/query.//g' ler_0_AnchorWave.sam; sed -i 's/col.//g' ler_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa ler_0_AnchorWave.sam | samtools sort - > ler_0_AnchorWave.bam; samtools index ler_0_AnchorWave.bam ; samtools depth ler_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\tler_0\t"$0}' >> depth
maf-convert sam mt_0.maf > mt_0_AnchorWave.sam ; sed -i 's/query.//g' mt_0_AnchorWave.sam; sed -i 's/col.//g' mt_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa mt_0_AnchorWave.sam | samtools sort - > mt_0_AnchorWave.bam; samtools index mt_0_AnchorWave.bam ; samtools depth mt_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\tmt_0\t"$0}' >> depth
maf-convert sam no_0.maf > no_0_AnchorWave.sam ; sed -i 's/query.//g' no_0_AnchorWave.sam; sed -i 's/col.//g' no_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa no_0_AnchorWave.sam | samtools sort - > no_0_AnchorWave.bam; samtools index no_0_AnchorWave.bam ; samtools depth no_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\tno_0\t"$0}' >> depth
maf-convert sam oy_0.maf > oy_0_AnchorWave.sam ; sed -i 's/query.//g' oy_0_AnchorWave.sam; sed -i 's/col.//g' oy_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa oy_0_AnchorWave.sam | samtools sort - > oy_0_AnchorWave.bam; samtools index oy_0_AnchorWave.bam ; samtools depth oy_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\toy_0\t"$0}' >> depth
maf-convert sam po_0.maf > po_0_AnchorWave.sam ; sed -i 's/query.//g' po_0_AnchorWave.sam; sed -i 's/col.//g' po_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa po_0_AnchorWave.sam | samtools sort - > po_0_AnchorWave.bam; samtools index po_0_AnchorWave.bam ; samtools depth po_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\tpo_0\t"$0}' >> depth
maf-convert sam rsch_4.maf > rsch_4_AnchorWave.sam ; sed -i 's/query.//g' rsch_4_AnchorWave.sam; sed -i 's/col.//g' rsch_4_AnchorWave.sam; samtools view -O BAM --reference tair10.fa rsch_4_AnchorWave.sam | samtools sort - > rsch_4_AnchorWave.bam; samtools index rsch_4_AnchorWave.bam ; samtools depth rsch_4_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\trsch_4\t"$0}' >> depth
maf-convert sam sf_2.maf > sf_2_AnchorWave.sam ; sed -i 's/query.//g' sf_2_AnchorWave.sam; sed -i 's/col.//g' sf_2_AnchorWave.sam; samtools view -O BAM --reference tair10.fa sf_2_AnchorWave.sam | samtools sort - > sf_2_AnchorWave.bam; samtools index sf_2_AnchorWave.bam ; samtools depth sf_2_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\tsf_2\t"$0}' >> depth
maf-convert sam tsu_0.maf > tsu_0_AnchorWave.sam ; sed -i 's/query.//g' tsu_0_AnchorWave.sam; sed -i 's/col.//g' tsu_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa tsu_0_AnchorWave.sam | samtools sort - > tsu_0_AnchorWave.bam; samtools index tsu_0_AnchorWave.bam ; samtools depth tsu_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\ttsu_0\t"$0}' >> depth
maf-convert sam wil_2.maf > wil_2_AnchorWave.sam ; sed -i 's/query.//g' wil_2_AnchorWave.sam; sed -i 's/col.//g' wil_2_AnchorWave.sam; samtools view -O BAM --reference tair10.fa wil_2_AnchorWave.sam | samtools sort - > wil_2_AnchorWave.bam; samtools index wil_2_AnchorWave.bam ; samtools depth wil_2_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\twil_2\t"$0}' >> depth
maf-convert sam ws_0.maf > ws_0_AnchorWave.sam ; sed -i 's/query.//g' ws_0_AnchorWave.sam; sed -i 's/col.//g' ws_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa ws_0_AnchorWave.sam | samtools sort - > ws_0_AnchorWave.bam; samtools index ws_0_AnchorWave.bam ; samtools depth ws_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\tws_0\t"$0}' >> depth
maf-convert sam wu_0.maf > wu_0_AnchorWave.sam ; sed -i 's/query.//g' wu_0_AnchorWave.sam; sed -i 's/col.//g' wu_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa wu_0_AnchorWave.sam | samtools sort - > wu_0_AnchorWave.bam; samtools index wu_0_AnchorWave.bam ; samtools depth wu_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\twu_0\t"$0}' >> depth
maf-convert sam zu_0.maf > zu_0_AnchorWave.sam ; sed -i 's/query.//g' zu_0_AnchorWave.sam; sed -i 's/col.//g' zu_0_AnchorWave.sam; samtools view -O BAM --reference tair10.fa zu_0_AnchorWave.sam | samtools sort - > zu_0_AnchorWave.bam; samtools index zu_0_AnchorWave.bam ; samtools depth zu_0_AnchorWave.bam | wc -l | awk '{print "AnchorWave\tAnchorWave\tzu_0\t"$0}' >> depth
samtools sort minimap2_asm5_bur_0.sam > minimap2_asm5_bur_0.bam; samtools index minimap2_asm5_bur_0.bam;samtools depth minimap2_asm5_bur_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\tbur_0\t"$0}' >> depth
samtools sort minimap2_asm5_can_0.sam > minimap2_asm5_can_0.bam; samtools index minimap2_asm5_can_0.bam;samtools depth minimap2_asm5_can_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\tcan_0\t"$0}' >> depth
samtools sort minimap2_asm5_ct_1.sam > minimap2_asm5_ct_1.bam; samtools index minimap2_asm5_ct_1.bam;samtools depth minimap2_asm5_ct_1.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\tct_1\t"$0}' >> depth
samtools sort minimap2_asm5_edi_0.sam > minimap2_asm5_edi_0.bam; samtools index minimap2_asm5_edi_0.bam;samtools depth minimap2_asm5_edi_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\tedi_0\t"$0}' >> depth
samtools sort minimap2_asm5_hi_0.sam > minimap2_asm5_hi_0.bam; samtools index minimap2_asm5_hi_0.bam;samtools depth minimap2_asm5_hi_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\thi_0\t"$0}' >> depth
samtools sort minimap2_asm5_kn_0.sam > minimap2_asm5_kn_0.bam; samtools index minimap2_asm5_kn_0.bam;samtools depth minimap2_asm5_kn_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\tkn_0\t"$0}' >> depth
samtools sort minimap2_asm5_ler_0.sam > minimap2_asm5_ler_0.bam; samtools index minimap2_asm5_ler_0.bam;samtools depth minimap2_asm5_ler_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\tler_0\t"$0}' >> depth
samtools sort minimap2_asm5_mt_0.sam > minimap2_asm5_mt_0.bam; samtools index minimap2_asm5_mt_0.bam;samtools depth minimap2_asm5_mt_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\tmt_0\t"$0}' >> depth
samtools sort minimap2_asm5_no_0.sam > minimap2_asm5_no_0.bam; samtools index minimap2_asm5_no_0.bam;samtools depth minimap2_asm5_no_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\tno_0\t"$0}' >> depth
samtools sort minimap2_asm5_oy_0.sam > minimap2_asm5_oy_0.bam; samtools index minimap2_asm5_oy_0.bam;samtools depth minimap2_asm5_oy_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\toy_0\t"$0}' >> depth
samtools sort minimap2_asm5_po_0.sam > minimap2_asm5_po_0.bam; samtools index minimap2_asm5_po_0.bam;samtools depth minimap2_asm5_po_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\tpo_0\t"$0}' >> depth
samtools sort minimap2_asm5_rsch_4.sam > minimap2_asm5_rsch_4.bam; samtools index minimap2_asm5_rsch_4.bam;samtools depth minimap2_asm5_rsch_4.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\trsch_4\t"$0}' >> depth
samtools sort minimap2_asm5_sf_2.sam > minimap2_asm5_sf_2.bam; samtools index minimap2_asm5_sf_2.bam;samtools depth minimap2_asm5_sf_2.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\tsf_2\t"$0}' >> depth
samtools sort minimap2_asm5_tsu_0.sam > minimap2_asm5_tsu_0.bam; samtools index minimap2_asm5_tsu_0.bam;samtools depth minimap2_asm5_tsu_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\ttsu_0\t"$0}' >> depth
samtools sort minimap2_asm5_wil_2.sam > minimap2_asm5_wil_2.bam; samtools index minimap2_asm5_wil_2.bam;samtools depth minimap2_asm5_wil_2.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\twil_2\t"$0}' >> depth
samtools sort minimap2_asm5_ws_0.sam > minimap2_asm5_ws_0.bam; samtools index minimap2_asm5_ws_0.bam;samtools depth minimap2_asm5_ws_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\tws_0\t"$0}' >> depth
samtools sort minimap2_asm5_wu_0.sam > minimap2_asm5_wu_0.bam; samtools index minimap2_asm5_wu_0.bam;samtools depth minimap2_asm5_wu_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\twu_0\t"$0}' >> depth
samtools sort minimap2_asm5_zu_0.sam > minimap2_asm5_zu_0.bam; samtools index minimap2_asm5_zu_0.bam;samtools depth minimap2_asm5_zu_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm5\tzu_0\t"$0}' >> depth
samtools sort minimap2_asm10_bur_0.sam > minimap2_bur_0.bam; samtools index minimap2_bur_0.bam;samtools depth minimap2_bur_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\tbur_0\t"$0}' >> depth
samtools sort minimap2_asm10_can_0.sam > minimap2_can_0.bam; samtools index minimap2_can_0.bam;samtools depth minimap2_can_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\tcan_0\t"$0}' >> depth
samtools sort minimap2_asm10_ct_1.sam > minimap2_ct_1.bam; samtools index minimap2_ct_1.bam;samtools depth minimap2_ct_1.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\tct_1\t"$0}' >> depth
samtools sort minimap2_asm10_edi_0.sam > minimap2_edi_0.bam; samtools index minimap2_edi_0.bam;samtools depth minimap2_edi_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\tedi_0\t"$0}' >> depth
samtools sort minimap2_asm10_hi_0.sam > minimap2_hi_0.bam; samtools index minimap2_hi_0.bam;samtools depth minimap2_hi_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\thi_0\t"$0}' >> depth
samtools sort minimap2_asm10_kn_0.sam > minimap2_kn_0.bam; samtools index minimap2_kn_0.bam;samtools depth minimap2_kn_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\tkn_0\t"$0}' >> depth
samtools sort minimap2_asm10_ler_0.sam > minimap2_ler_0.bam; samtools index minimap2_ler_0.bam;samtools depth minimap2_ler_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\tler_0\t"$0}' >> depth
samtools sort minimap2_asm10_mt_0.sam > minimap2_mt_0.bam; samtools index minimap2_mt_0.bam;samtools depth minimap2_mt_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\tmt_0\t"$0}' >> depth
samtools sort minimap2_asm10_no_0.sam > minimap2_no_0.bam; samtools index minimap2_no_0.bam;samtools depth minimap2_no_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\tno_0\t"$0}' >> depth
samtools sort minimap2_asm10_oy_0.sam > minimap2_oy_0.bam; samtools index minimap2_oy_0.bam;samtools depth minimap2_oy_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\toy_0\t"$0}' >> depth
samtools sort minimap2_asm10_po_0.sam > minimap2_po_0.bam; samtools index minimap2_po_0.bam;samtools depth minimap2_po_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\tpo_0\t"$0}' >> depth
samtools sort minimap2_asm10_rsch_4.sam > minimap2_rsch_4.bam; samtools index minimap2_rsch_4.bam;samtools depth minimap2_rsch_4.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\trsch_4\t"$0}' >> depth
samtools sort minimap2_asm10_sf_2.sam > minimap2_sf_2.bam; samtools index minimap2_sf_2.bam;samtools depth minimap2_sf_2.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\tsf_2\t"$0}' >> depth
samtools sort minimap2_asm10_tsu_0.sam > minimap2_tsu_0.bam; samtools index minimap2_tsu_0.bam;samtools depth minimap2_tsu_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\ttsu_0\t"$0}' >> depth
samtools sort minimap2_asm10_wil_2.sam > minimap2_wil_2.bam; samtools index minimap2_wil_2.bam;samtools depth minimap2_wil_2.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\twil_2\t"$0}' >> depth
samtools sort minimap2_asm10_ws_0.sam > minimap2_ws_0.bam; samtools index minimap2_ws_0.bam;samtools depth minimap2_ws_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\tws_0\t"$0}' >> depth
samtools sort minimap2_asm10_wu_0.sam > minimap2_wu_0.bam; samtools index minimap2_wu_0.bam;samtools depth minimap2_wu_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\twu_0\t"$0}' >> depth
samtools sort minimap2_asm10_zu_0.sam > minimap2_zu_0.bam; samtools index minimap2_zu_0.bam;samtools depth minimap2_zu_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm10\tzu_0\t"$0}' >> depth
samtools sort minimap2_asm20_bur_0.sam > minimap2_asm20_bur_0.bam; samtools index minimap2_asm20_bur_0.bam;samtools depth minimap2_asm20_bur_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\tbur_0\t"$0}' >> depth
samtools sort minimap2_asm20_can_0.sam > minimap2_asm20_can_0.bam; samtools index minimap2_asm20_can_0.bam;samtools depth minimap2_asm20_can_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\tcan_0\t"$0}' >> depth
samtools sort minimap2_asm20_ct_1.sam > minimap2_asm20_ct_1.bam; samtools index minimap2_asm20_ct_1.bam;samtools depth minimap2_asm20_ct_1.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\tct_1\t"$0}' >> depth
samtools sort minimap2_asm20_edi_0.sam > minimap2_asm20_edi_0.bam; samtools index minimap2_asm20_edi_0.bam;samtools depth minimap2_asm20_edi_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\tedi_0\t"$0}' >> depth
samtools sort minimap2_asm20_hi_0.sam > minimap2_asm20_hi_0.bam; samtools index minimap2_asm20_hi_0.bam;samtools depth minimap2_asm20_hi_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\thi_0\t"$0}' >> depth
samtools sort minimap2_asm20_kn_0.sam > minimap2_asm20_kn_0.bam; samtools index minimap2_asm20_kn_0.bam;samtools depth minimap2_asm20_kn_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\tkn_0\t"$0}' >> depth
samtools sort minimap2_asm20_ler_0.sam > minimap2_asm20_ler_0.bam; samtools index minimap2_asm20_ler_0.bam;samtools depth minimap2_asm20_ler_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\tler_0\t"$0}' >> depth
samtools sort minimap2_asm20_mt_0.sam > minimap2_asm20_mt_0.bam; samtools index minimap2_asm20_mt_0.bam;samtools depth minimap2_asm20_mt_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\tmt_0\t"$0}' >> depth
samtools sort minimap2_asm20_no_0.sam > minimap2_asm20_no_0.bam; samtools index minimap2_asm20_no_0.bam;samtools depth minimap2_asm20_no_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\tno_0\t"$0}' >> depth
samtools sort minimap2_asm20_oy_0.sam > minimap2_asm20_oy_0.bam; samtools index minimap2_asm20_oy_0.bam;samtools depth minimap2_asm20_oy_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\toy_0\t"$0}' >> depth
samtools sort minimap2_asm20_po_0.sam > minimap2_asm20_po_0.bam; samtools index minimap2_asm20_po_0.bam;samtools depth minimap2_asm20_po_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\tpo_0\t"$0}' >> depth
samtools sort minimap2_asm20_rsch_4.sam > minimap2_asm20_rsch_4.bam; samtools index minimap2_asm20_rsch_4.bam;samtools depth minimap2_asm20_rsch_4.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\trsch_4\t"$0}' >> depth
samtools sort minimap2_asm20_sf_2.sam > minimap2_asm20_sf_2.bam; samtools index minimap2_asm20_sf_2.bam;samtools depth minimap2_asm20_sf_2.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\tsf_2\t"$0}' >> depth
samtools sort minimap2_asm20_tsu_0.sam > minimap2_asm20_tsu_0.bam; samtools index minimap2_asm20_tsu_0.bam;samtools depth minimap2_asm20_tsu_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\ttsu_0\t"$0}' >> depth
samtools sort minimap2_asm20_wil_2.sam > minimap2_asm20_wil_2.bam; samtools index minimap2_asm20_wil_2.bam;samtools depth minimap2_asm20_wil_2.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\twil_2\t"$0}' >> depth
samtools sort minimap2_asm20_ws_0.sam > minimap2_asm20_ws_0.bam; samtools index minimap2_asm20_ws_0.bam;samtools depth minimap2_asm20_ws_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\tws_0\t"$0}' >> depth
samtools sort minimap2_asm20_wu_0.sam > minimap2_asm20_wu_0.bam; samtools index minimap2_asm20_wu_0.bam;samtools depth minimap2_asm20_wu_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\twu_0\t"$0}' >> depth
samtools sort minimap2_asm20_zu_0.sam > minimap2_asm20_zu_0.bam; samtools index minimap2_asm20_zu_0.bam;samtools depth minimap2_asm20_zu_0.bam | wc -l | awk '{print "minimap2\tminimap2_asm20\tzu_0\t"$0}' >> depth
grep -v "@" mumer.bur_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.bur_0.short.bam; samtools index mumer.bur_0.short.bam; samtools depth mumer.bur_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\tbur_0\t"$0}' >> depth
grep -v "@" mumer.can_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.can_0.short.bam; samtools index mumer.can_0.short.bam; samtools depth mumer.can_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\tcan_0\t"$0}' >> depth
grep -v "@" mumer.ct_1.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.ct_1.short.bam; samtools index mumer.ct_1.short.bam; samtools depth mumer.ct_1.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\tct_1\t"$0}' >> depth
grep -v "@" mumer.edi_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.edi_0.short.bam; samtools index mumer.edi_0.short.bam; samtools depth mumer.edi_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\tedi_0\t"$0}' >> depth
grep -v "@" mumer.hi_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.hi_0.short.bam; samtools index mumer.hi_0.short.bam; samtools depth mumer.hi_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\thi_0\t"$0}' >> depth
grep -v "@" mumer.kn_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.kn_0.short.bam; samtools index mumer.kn_0.short.bam; samtools depth mumer.kn_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\tkn_0\t"$0}' >> depth
grep -v "@" mumer.ler_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.ler_0.short.bam; samtools index mumer.ler_0.short.bam; samtools depth mumer.ler_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\tler_0\t"$0}' >> depth
grep -v "@" mumer.mt_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.mt_0.short.bam; samtools index mumer.mt_0.short.bam; samtools depth mumer.mt_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\tmt_0\t"$0}' >> depth
grep -v "@" mumer.no_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.no_0.short.bam; samtools index mumer.no_0.short.bam; samtools depth mumer.no_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\tno_0\t"$0}' >> depth
grep -v "@" mumer.oy_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.oy_0.short.bam; samtools index mumer.oy_0.short.bam; samtools depth mumer.oy_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\toy_0\t"$0}' >> depth
grep -v "@" mumer.po_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.po_0.short.bam; samtools index mumer.po_0.short.bam; samtools depth mumer.po_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\tpo_0\t"$0}' >> depth
grep -v "@" mumer.rsch_4.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.rsch_4.short.bam; samtools index mumer.rsch_4.short.bam; samtools depth mumer.rsch_4.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\trsch_4\t"$0}' >> depth
grep -v "@" mumer.sf_2.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.sf_2.short.bam; samtools index mumer.sf_2.short.bam; samtools depth mumer.sf_2.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\tsf_2\t"$0}' >> depth
awk 'NR > 4 { print }' mumer.tsu_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.tsu_0.short.bam; samtools index mumer.tsu_0.short.bam; samtools depth mumer.tsu_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\ttsu_0\t"$0}' >> depth
grep -v "@" mumer.wil_2.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.wil_2.short.bam; samtools index mumer.wil_2.short.bam; samtools depth mumer.wil_2.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\twil_2\t"$0}' >> depth
awk 'NR > 3 { print }' mumer.ws_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.ws_0.short.bam; samtools index mumer.ws_0.short.bam; samtools depth mumer.ws_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\tws_0\t"$0}' >> depth
grep -v "@" mumer.wu_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.wu_0.short.bam; samtools index mumer.wu_0.short.bam; samtools depth mumer.wu_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\twu_0\t"$0}' >> depth
awk 'NR > 3 { print }' mumer.zu_0.short.sam | samtools view -O BAM --reference tair10.fa - | samtools sort - > mumer.zu_0.short.bam; samtools index mumer.zu_0.short.bam; samtools depth mumer.zu_0.short.bam | wc -l | awk '{print "MUMmer4\tMUMmer4\tzu_0\t"$0}' >> depth
maf-convert sam bur_0_lastal_final_split.maf > bur_0_lastal_final_split.sam ; sed -i 's/query.//g' bur_0_lastal_final_split.sam; sed -i 's/col.//g' bur_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa bur_0_lastal_final_split.sam | samtools sort - > bur_0_lastal_final_split.bam; samtools index bur_0_lastal_final_split.bam ; samtools depth bur_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\tbur_0\t"$0}' >> depth
maf-convert sam can_0_lastal_final_split.maf > can_0_lastal_final_split.sam ; sed -i 's/query.//g' can_0_lastal_final_split.sam; sed -i 's/col.//g' can_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa can_0_lastal_final_split.sam | samtools sort - > can_0_lastal_final_split.bam; samtools index can_0_lastal_final_split.bam ; samtools depth can_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\tcan_0\t"$0}' >> depth
maf-convert sam ct_1_lastal_final_split.maf > ct_1_lastal_final_split.sam ; sed -i 's/query.//g' ct_1_lastal_final_split.sam; sed -i 's/col.//g' ct_1_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa ct_1_lastal_final_split.sam | samtools sort - > ct_1_lastal_final_split.bam; samtools index ct_1_lastal_final_split.bam ; samtools depth ct_1_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\tct_1\t"$0}' >> depth
maf-convert sam edi_0_lastal_final_split.maf > edi_0_lastal_final_split.sam ; sed -i 's/query.//g' edi_0_lastal_final_split.sam; sed -i 's/col.//g' edi_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa edi_0_lastal_final_split.sam | samtools sort - > edi_0_lastal_final_split.bam; samtools index edi_0_lastal_final_split.bam ; samtools depth edi_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\tedi_0\t"$0}' >> depth
maf-convert sam hi_0_lastal_final_split.maf > hi_0_lastal_final_split.sam ; sed -i 's/query.//g' hi_0_lastal_final_split.sam; sed -i 's/col.//g' hi_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa hi_0_lastal_final_split.sam | samtools sort - > hi_0_lastal_final_split.bam; samtools index hi_0_lastal_final_split.bam ; samtools depth hi_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\thi_0\t"$0}' >> depth
maf-convert sam kn_0_lastal_final_split.maf > kn_0_lastal_final_split.sam ; sed -i 's/query.//g' kn_0_lastal_final_split.sam; sed -i 's/col.//g' kn_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa kn_0_lastal_final_split.sam | samtools sort - > kn_0_lastal_final_split.bam; samtools index kn_0_lastal_final_split.bam ; samtools depth kn_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\tkn_0\t"$0}' >> depth
maf-convert sam ler_0_lastal_final_split.maf > ler_0_lastal_final_split.sam ; sed -i 's/query.//g' ler_0_lastal_final_split.sam; sed -i 's/col.//g' ler_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa ler_0_lastal_final_split.sam | samtools sort - > ler_0_lastal_final_split.bam; samtools index ler_0_lastal_final_split.bam ; samtools depth ler_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\tler_0\t"$0}' >> depth
maf-convert sam mt_0_lastal_final_split.maf > mt_0_lastal_final_split.sam ; sed -i 's/query.//g' mt_0_lastal_final_split.sam; sed -i 's/col.//g' mt_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa mt_0_lastal_final_split.sam | samtools sort - > mt_0_lastal_final_split.bam; samtools index mt_0_lastal_final_split.bam ; samtools depth mt_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\tmt_0\t"$0}' >> depth
maf-convert sam no_0_lastal_final_split.maf > no_0_lastal_final_split.sam ; sed -i 's/query.//g' no_0_lastal_final_split.sam; sed -i 's/col.//g' no_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa no_0_lastal_final_split.sam | samtools sort - > no_0_lastal_final_split.bam; samtools index no_0_lastal_final_split.bam ; samtools depth no_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\tno_0\t"$0}' >> depth
maf-convert sam oy_0_lastal_final_split.maf > oy_0_lastal_final_split.sam ; sed -i 's/query.//g' oy_0_lastal_final_split.sam; sed -i 's/col.//g' oy_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa oy_0_lastal_final_split.sam | samtools sort - > oy_0_lastal_final_split.bam; samtools index oy_0_lastal_final_split.bam ; samtools depth oy_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\toy_0\t"$0}' >> depth
maf-convert sam po_0_lastal_final_split.maf > po_0_lastal_final_split.sam ; sed -i 's/query.//g' po_0_lastal_final_split.sam; sed -i 's/col.//g' po_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa po_0_lastal_final_split.sam | samtools sort - > po_0_lastal_final_split.bam; samtools index po_0_lastal_final_split.bam ; samtools depth po_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\tpo_0\t"$0}' >> depth
maf-convert sam rsch_4_lastal_final_split.maf > rsch_4_lastal_final_split.sam ; sed -i 's/query.//g' rsch_4_lastal_final_split.sam; sed -i 's/col.//g' rsch_4_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa rsch_4_lastal_final_split.sam | samtools sort - > rsch_4_lastal_final_split.bam; samtools index rsch_4_lastal_final_split.bam ; samtools depth rsch_4_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\trsch_4\t"$0}' >> depth
maf-convert sam sf_2_lastal_final_split.maf > sf_2_lastal_final_split.sam ; sed -i 's/query.//g' sf_2_lastal_final_split.sam; sed -i 's/col.//g' sf_2_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa sf_2_lastal_final_split.sam | samtools sort - > sf_2_lastal_final_split.bam; samtools index sf_2_lastal_final_split.bam ; samtools depth sf_2_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\tsf_2\t"$0}' >> depth
maf-convert sam tsu_0_lastal_final_split.maf > tsu_0_lastal_final_split.sam ; sed -i 's/query.//g' tsu_0_lastal_final_split.sam; sed -i 's/col.//g' tsu_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa tsu_0_lastal_final_split.sam | samtools sort - > tsu_0_lastal_final_split.bam; samtools index tsu_0_lastal_final_split.bam ; samtools depth tsu_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\ttsu_0\t"$0}' >> depth
maf-convert sam wil_2_lastal_final_split.maf > wil_2_lastal_final_split.sam ; sed -i 's/query.//g' wil_2_lastal_final_split.sam; sed -i 's/col.//g' wil_2_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa wil_2_lastal_final_split.sam | samtools sort - > wil_2_lastal_final_split.bam; samtools index wil_2_lastal_final_split.bam ; samtools depth wil_2_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\twil_2\t"$0}' >> depth
maf-convert sam ws_0_lastal_final_split.maf > ws_0_lastal_final_split.sam ; sed -i 's/query.//g' ws_0_lastal_final_split.sam; sed -i 's/col.//g' ws_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa ws_0_lastal_final_split.sam | samtools sort - > ws_0_lastal_final_split.bam; samtools index ws_0_lastal_final_split.bam ; samtools depth ws_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\tws_0\t"$0}' >> depth
maf-convert sam wu_0_lastal_final_split.maf > wu_0_lastal_final_split.sam ; sed -i 's/query.//g' wu_0_lastal_final_split.sam; sed -i 's/col.//g' wu_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa wu_0_lastal_final_split.sam | samtools sort - > wu_0_lastal_final_split.bam; samtools index wu_0_lastal_final_split.bam ; samtools depth wu_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\twu_0\t"$0}' >> depth
maf-convert sam zu_0_lastal_final_split.maf > zu_0_lastal_final_split.sam ; sed -i 's/query.//g' zu_0_lastal_final_split.sam; sed -i 's/col.//g' zu_0_lastal_final_split.sam; samtools view -O BAM --reference tair10.fa zu_0_lastal_final_split.sam | samtools sort - > zu_0_lastal_final_split.bam; samtools index zu_0_lastal_final_split.bam ; samtools depth zu_0_lastal_final_split.bam | wc -l | awk '{print "LAST\tLAST+one-to-one\tzu_0\t"$0}' >> depth
maf-convert sam bur_0_gsalign_temp.maf > bur_0_gsalign.sam ; sed -i 's/query.//g' bur_0_gsalign.sam; sed -i 's/col.//g' bur_0_gsalign.sam; samtools view -O BAM --reference tair10.fa bur_0_gsalign.sam | samtools sort - > bur_0_gsalign.bam; samtools index bur_0_gsalign.bam ; samtools depth bur_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\tbur_0\t"$0}' >> depth
maf-convert sam can_0_gsalign_temp.maf > can_0_gsalign.sam ; sed -i 's/query.//g' can_0_gsalign.sam; sed -i 's/col.//g' can_0_gsalign.sam; samtools view -O BAM --reference tair10.fa can_0_gsalign.sam | samtools sort - > can_0_gsalign.bam; samtools index can_0_gsalign.bam ; samtools depth can_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\tcan_0\t"$0}' >> depth
maf-convert sam ct_1_gsalign_temp.maf > ct_1_gsalign.sam ; sed -i 's/query.//g' ct_1_gsalign.sam; sed -i 's/col.//g' ct_1_gsalign.sam; samtools view -O BAM --reference tair10.fa ct_1_gsalign.sam | samtools sort - > ct_1_gsalign.bam; samtools index ct_1_gsalign.bam ; samtools depth ct_1_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\tct_1\t"$0}' >> depth
maf-convert sam edi_0_gsalign_temp.maf > edi_0_gsalign.sam ; sed -i 's/query.//g' edi_0_gsalign.sam; sed -i 's/col.//g' edi_0_gsalign.sam; samtools view -O BAM --reference tair10.fa edi_0_gsalign.sam | samtools sort - > edi_0_gsalign.bam; samtools index edi_0_gsalign.bam ; samtools depth edi_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\tedi_0\t"$0}' >> depth
maf-convert sam hi_0_gsalign_temp.maf > hi_0_gsalign.sam ; sed -i 's/query.//g' hi_0_gsalign.sam; sed -i 's/col.//g' hi_0_gsalign.sam; samtools view -O BAM --reference tair10.fa hi_0_gsalign.sam | samtools sort - > hi_0_gsalign.bam; samtools index hi_0_gsalign.bam ; samtools depth hi_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\thi_0\t"$0}' >> depth
maf-convert sam kn_0_gsalign_temp.maf > kn_0_gsalign.sam ; sed -i 's/query.//g' kn_0_gsalign.sam; sed -i 's/col.//g' kn_0_gsalign.sam; samtools view -O BAM --reference tair10.fa kn_0_gsalign.sam | samtools sort - > kn_0_gsalign.bam; samtools index kn_0_gsalign.bam ; samtools depth kn_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\tkn_0\t"$0}' >> depth
maf-convert sam ler_0_gsalign_temp.maf > ler_0_gsalign.sam ; sed -i 's/query.//g' ler_0_gsalign.sam; sed -i 's/col.//g' ler_0_gsalign.sam; samtools view -O BAM --reference tair10.fa ler_0_gsalign.sam | samtools sort - > ler_0_gsalign.bam; samtools index ler_0_gsalign.bam ; samtools depth ler_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\tler_0\t"$0}' >> depth
maf-convert sam mt_0_gsalign_temp.maf > mt_0_gsalign.sam ; sed -i 's/query.//g' mt_0_gsalign.sam; sed -i 's/col.//g' mt_0_gsalign.sam; samtools view -O BAM --reference tair10.fa mt_0_gsalign.sam | samtools sort - > mt_0_gsalign.bam; samtools index mt_0_gsalign.bam ; samtools depth mt_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\tmt_0\t"$0}' >> depth
maf-convert sam no_0_gsalign_temp.maf > no_0_gsalign.sam ; sed -i 's/query.//g' no_0_gsalign.sam; sed -i 's/col.//g' no_0_gsalign.sam; samtools view -O BAM --reference tair10.fa no_0_gsalign.sam | samtools sort - > no_0_gsalign.bam; samtools index no_0_gsalign.bam ; samtools depth no_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\tno_0\t"$0}' >> depth
maf-convert sam oy_0_gsalign_temp.maf > oy_0_gsalign.sam ; sed -i 's/query.//g' oy_0_gsalign.sam; sed -i 's/col.//g' oy_0_gsalign.sam; samtools view -O BAM --reference tair10.fa oy_0_gsalign.sam | samtools sort - > oy_0_gsalign.bam; samtools index oy_0_gsalign.bam ; samtools depth oy_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\toy_0\t"$0}' >> depth
maf-convert sam po_0_gsalign_temp.maf > po_0_gsalign.sam ; sed -i 's/query.//g' po_0_gsalign.sam; sed -i 's/col.//g' po_0_gsalign.sam; samtools view -O BAM --reference tair10.fa po_0_gsalign.sam | samtools sort - > po_0_gsalign.bam; samtools index po_0_gsalign.bam ; samtools depth po_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\tpo_0\t"$0}' >> depth
maf-convert sam rsch_4_gsalign_temp.maf > rsch_4_gsalign.sam ; sed -i 's/query.//g' rsch_4_gsalign.sam; sed -i 's/col.//g' rsch_4_gsalign.sam; samtools view -O BAM --reference tair10.fa rsch_4_gsalign.sam | samtools sort - > rsch_4_gsalign.bam; samtools index rsch_4_gsalign.bam ; samtools depth rsch_4_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\trsch_4\t"$0}' >> depth
maf-convert sam sf_2_gsalign_temp.maf > sf_2_gsalign.sam ; sed -i 's/query.//g' sf_2_gsalign.sam; sed -i 's/col.//g' sf_2_gsalign.sam; samtools view -O BAM --reference tair10.fa sf_2_gsalign.sam | samtools sort - > sf_2_gsalign.bam; samtools index sf_2_gsalign.bam ; samtools depth sf_2_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\tsf_2\t"$0}' >> depth
maf-convert sam tsu_0_gsalign_temp.maf > tsu_0_gsalign.sam ; sed -i 's/query.//g' tsu_0_gsalign.sam; sed -i 's/col.//g' tsu_0_gsalign.sam; samtools view -O BAM --reference tair10.fa tsu_0_gsalign.sam | samtools sort - > tsu_0_gsalign.bam; samtools index tsu_0_gsalign.bam ; samtools depth tsu_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\ttsu_0\t"$0}' >> depth
maf-convert sam wil_2_gsalign_temp.maf > wil_2_gsalign.sam ; sed -i 's/query.//g' wil_2_gsalign.sam; sed -i 's/col.//g' wil_2_gsalign.sam; samtools view -O BAM --reference tair10.fa wil_2_gsalign.sam | samtools sort - > wil_2_gsalign.bam; samtools index wil_2_gsalign.bam ; samtools depth wil_2_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\twil_2\t"$0}' >> depth
maf-convert sam ws_0_gsalign_temp.maf > ws_0_gsalign.sam ; sed -i 's/query.//g' ws_0_gsalign.sam; sed -i 's/col.//g' ws_0_gsalign.sam; samtools view -O BAM --reference tair10.fa ws_0_gsalign.sam | samtools sort - > ws_0_gsalign.bam; samtools index ws_0_gsalign.bam ; samtools depth ws_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\tws_0\t"$0}' >> depth
maf-convert sam wu_0_gsalign_temp.maf > wu_0_gsalign.sam ; sed -i 's/query.//g' wu_0_gsalign.sam; sed -i 's/col.//g' wu_0_gsalign.sam; samtools view -O BAM --reference tair10.fa wu_0_gsalign.sam | samtools sort - > wu_0_gsalign.bam; samtools index wu_0_gsalign.bam ; samtools depth wu_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\twu_0\t"$0}' >> depth
maf-convert sam zu_0_gsalign_temp.maf > zu_0_gsalign.sam ; sed -i 's/query.//g' zu_0_gsalign.sam; sed -i 's/col.//g' zu_0_gsalign.sam; samtools view -O BAM --reference tair10.fa zu_0_gsalign.sam | samtools sort - > zu_0_gsalign.bam; samtools index zu_0_gsalign.bam ; samtools depth zu_0_gsalign.bam | wc -l | awk '{print "GSAlign\tGSAlign\tzu_0\t"$0}' >> depth
Plot the results
library(ggplot2)
dat = read.table("summaryTable")
print(dat)
## V1 V2 V3 V4 V5 V6
## 1 AnchorWave AnchorWave bur_0 0.9031112 0.91017788 0.90663077
## 2 AnchorWave AnchorWave can_0 0.9066598 0.90175710 0.90420181
## 3 AnchorWave AnchorWave ct_1 0.9248941 0.92152402 0.92320600
## 4 AnchorWave AnchorWave edi_0 0.8992429 0.90639800 0.90280629
## 5 AnchorWave AnchorWave hi_0 0.9043866 0.90053995 0.90245916
## 6 AnchorWave AnchorWave kn_0 0.9073096 0.91627318 0.91176937
## 7 AnchorWave AnchorWave ler_0 0.9082468 0.91601995 0.91211683
## 8 AnchorWave AnchorWave mt_0 0.9234137 0.92031841 0.92186345
## 9 AnchorWave AnchorWave no_0 0.9095424 0.91730858 0.91340898
## 10 AnchorWave AnchorWave oy_0 0.9271004 0.92552230 0.92631069
## 11 AnchorWave AnchorWave po_0 0.9044536 0.90465833 0.90455594
## 12 AnchorWave AnchorWave rsch_4 0.9115703 0.92046080 0.91599397
## 13 AnchorWave AnchorWave sf_2 0.9048916 0.91237296 0.90861688
## 14 AnchorWave AnchorWave tsu_0 0.9088023 0.92160909 0.91516088
## 15 AnchorWave AnchorWave wil_2 0.9125996 0.92179142 0.91717248
## 16 AnchorWave AnchorWave ws_0 0.9072561 0.91387981 0.91055589
## 17 AnchorWave AnchorWave wu_0 0.9127664 0.91795155 0.91535164
## 18 AnchorWave AnchorWave zu_0 0.9077923 0.91456636 0.91116674
## 19 minimap2 minimap2_asm5 bur_0 0.6057271 0.97745342 0.74795014
## 20 minimap2 minimap2_asm5 can_0 0.5304668 0.97547579 0.68722081
## 21 minimap2 minimap2_asm5 ct_1 0.6173098 0.98234568 0.75817780
## 22 minimap2 minimap2_asm5 edi_0 0.5762188 0.97277394 0.72373566
## 23 minimap2 minimap2_asm5 hi_0 0.6924787 0.97753175 0.81067745
## 24 minimap2 minimap2_asm5 kn_0 0.5864700 0.97251803 0.73169603
## 25 minimap2 minimap2_asm5 ler_0 0.5858250 0.97799147 0.73273543
## 26 minimap2 minimap2_asm5 mt_0 0.5643707 0.97324591 0.71444529
## 27 minimap2 minimap2_asm5 no_0 0.5648414 0.97766243 0.71601014
## 28 minimap2 minimap2_asm5 oy_0 0.5746724 0.97924751 0.72429280
## 29 minimap2 minimap2_asm5 po_0 0.6401784 0.97585771 0.77315478
## 30 minimap2 minimap2_asm5 rsch_4 0.5672282 0.97732102 0.71783283
## 31 minimap2 minimap2_asm5 sf_2 0.5424679 0.97596742 0.69733760
## 32 minimap2 minimap2_asm5 tsu_0 0.5400662 0.97211112 0.69436878
## 33 minimap2 minimap2_asm5 wil_2 0.5417401 0.97500123 0.69648955
## 34 minimap2 minimap2_asm5 ws_0 0.5746529 0.97465760 0.72301818
## 35 minimap2 minimap2_asm5 wu_0 0.5564866 0.97844143 0.70946592
## 36 minimap2 minimap2_asm5 zu_0 0.5560964 0.97860119 0.70919064
## 37 minimap2 minimap2_asm10 bur_0 0.7388932 0.96715448 0.83775367
## 38 minimap2 minimap2_asm10 can_0 0.6702227 0.96552911 0.79121969
## 39 minimap2 minimap2_asm10 ct_1 0.7489832 0.97524399 0.84726809
## 40 minimap2 minimap2_asm10 edi_0 0.7098205 0.95894581 0.81578753
## 41 minimap2 minimap2_asm10 hi_0 0.7989792 0.96890570 0.87577591
## 42 minimap2 minimap2_asm10 kn_0 0.7078307 0.96201618 0.81557725
## 43 minimap2 minimap2_asm10 ler_0 0.7003021 0.96786961 0.81262750
## 44 minimap2 minimap2_asm10 mt_0 0.6817799 0.96802203 0.80006935
## 45 minimap2 minimap2_asm10 no_0 0.6829294 0.96742857 0.80065707
## 46 minimap2 minimap2_asm10 oy_0 0.7103640 0.97078807 0.82040517
## 47 minimap2 minimap2_asm10 po_0 0.7489433 0.96828360 0.84460536
## 48 minimap2 minimap2_asm10 rsch_4 0.7015224 0.96838594 0.81363078
## 49 minimap2 minimap2_asm10 sf_2 0.6740861 0.96688522 0.79436351
## 50 minimap2 minimap2_asm10 tsu_0 0.6700576 0.96417618 0.79065016
## 51 minimap2 minimap2_asm10 wil_2 0.6763220 0.96735522 0.79607310
## 52 minimap2 minimap2_asm10 ws_0 0.7035468 0.96240326 0.81286440
## 53 minimap2 minimap2_asm10 wu_0 0.6875002 0.96827298 0.80408100
## 54 minimap2 minimap2_asm10 zu_0 0.6946206 0.96726426 0.80857788
## 55 minimap2 minimap2_asm20 bur_0 0.7691043 0.95480164 0.85195140
## 56 minimap2 minimap2_asm20 can_0 0.7031152 0.95220773 0.80891976
## 57 minimap2 minimap2_asm20 ct_1 0.7605779 0.96824674 0.85193962
## 58 minimap2 minimap2_asm20 edi_0 0.7440793 0.94957747 0.83436143
## 59 minimap2 minimap2_asm20 hi_0 0.8094245 0.96383347 0.87990632
## 60 minimap2 minimap2_asm20 kn_0 0.7294578 0.95282541 0.82631265
## 61 minimap2 minimap2_asm20 ler_0 0.7370258 0.95624568 0.83244504
## 62 minimap2 minimap2_asm20 mt_0 0.7072072 0.95385260 0.81221810
## 63 minimap2 minimap2_asm20 no_0 0.7253476 0.95788250 0.82555292
## 64 minimap2 minimap2_asm20 oy_0 0.7274160 0.96398896 0.82915803
## 65 minimap2 minimap2_asm20 po_0 0.7798712 0.93610145 0.85087437
## 66 minimap2 minimap2_asm20 rsch_4 0.7331573 0.96010574 0.83142257
## 67 minimap2 minimap2_asm20 sf_2 0.7412284 0.95673771 0.83530662
## 68 minimap2 minimap2_asm20 tsu_0 0.6952200 0.94868315 0.80241164
## 69 minimap2 minimap2_asm20 wil_2 0.7167730 0.95891177 0.82034772
## 70 minimap2 minimap2_asm20 ws_0 0.7361925 0.95238282 0.83044811
## 71 minimap2 minimap2_asm20 wu_0 0.7255851 0.95856355 0.82595968
## 72 minimap2 minimap2_asm20 zu_0 0.7255218 0.94941682 0.82250486
## 73 MUMmer4 MUMmer4 bur_0 0.2774978 0.01920515 0.03592406
## 74 MUMmer4 MUMmer4 can_0 0.2699532 0.02210518 0.04086418
## 75 MUMmer4 MUMmer4 ct_1 0.2797962 0.01767545 0.03325039
## 76 MUMmer4 MUMmer4 edi_0 0.2671473 0.01747795 0.03280938
## 77 MUMmer4 MUMmer4 hi_0 0.3495808 0.01715943 0.03271311
## 78 MUMmer4 MUMmer4 kn_0 0.2669763 0.01803705 0.03379116
## 79 MUMmer4 MUMmer4 ler_0 0.2661279 0.01842771 0.03446867
## 80 MUMmer4 MUMmer4 mt_0 0.2517855 0.01704383 0.03192650
## 81 MUMmer4 MUMmer4 no_0 0.2530920 0.01750494 0.03274509
## 82 MUMmer4 MUMmer4 oy_0 0.2713288 0.01738110 0.03266943
## 83 MUMmer4 MUMmer4 po_0 0.3670593 0.01823982 0.03475272
## 84 MUMmer4 MUMmer4 rsch_4 0.2576849 0.01666810 0.03131089
## 85 MUMmer4 MUMmer4 sf_2 0.2738137 0.01975760 0.03685579
## 86 MUMmer4 MUMmer4 tsu_0 0.2482104 0.01737836 0.03248247
## 87 MUMmer4 MUMmer4 wil_2 0.2514938 0.01898411 0.03530333
## 88 MUMmer4 MUMmer4 ws_0 0.2718408 0.01837364 0.03442079
## 89 MUMmer4 MUMmer4 wu_0 0.2580745 0.01711671 0.03210412
## 90 MUMmer4 MUMmer4 zu_0 0.2651190 0.01788622 0.03351158
## 91 GSAlign GSAlign bur_0 0.2746941 0.82472803 0.41212182
## 92 GSAlign GSAlign can_0 0.2681868 0.82114159 0.40432125
## 93 GSAlign GSAlign ct_1 0.2751915 0.85293496 0.41612438
## 94 GSAlign GSAlign edi_0 0.2648330 0.81094485 0.39927379
## 95 GSAlign GSAlign hi_0 0.3471730 0.84054612 0.49138710
## 96 GSAlign GSAlign kn_0 0.2649070 0.80693938 0.39887041
## 97 GSAlign GSAlign ler_0 0.2655360 0.82522467 0.40178729
## 98 GSAlign GSAlign mt_0 0.2503669 0.83729184 0.38547044
## 99 GSAlign GSAlign no_0 0.2507705 0.82878968 0.38503825
## 100 GSAlign GSAlign oy_0 0.2686629 0.85001284 0.40828079
## 101 GSAlign GSAlign po_0 0.3629425 0.84366273 0.50754144
## 102 GSAlign GSAlign rsch_4 0.2540719 0.81754231 0.38766664
## 103 GSAlign GSAlign sf_2 0.2727402 0.81672505 0.40892315
## 104 GSAlign GSAlign tsu_0 0.2460868 0.80870161 0.37734727
## 105 GSAlign GSAlign wil_2 0.2516590 0.82449414 0.38561685
## 106 GSAlign GSAlign ws_0 0.2706208 0.81925166 0.40684860
## 107 GSAlign GSAlign wu_0 0.2573991 0.82594629 0.39248390
## 108 GSAlign GSAlign zu_0 0.2636613 0.81593570 0.39853888
## 109 LAST LAST+one-to-one bur_0 0.2562099 0.83538376 0.39214883
## 110 LAST LAST+one-to-one can_0 0.2484223 0.82272750 0.38161586
## 111 LAST LAST+one-to-one ct_1 0.2571746 0.85755912 0.39568632
## 112 LAST LAST+one-to-one edi_0 0.2477309 0.82368688 0.38090225
## 113 LAST LAST+one-to-one hi_0 0.3283373 0.85285987 0.47413883
## 114 LAST LAST+one-to-one kn_0 0.2472900 0.83092496 0.38114738
## 115 LAST LAST+one-to-one ler_0 0.2461349 0.82952991 0.37962802
## 116 LAST LAST+one-to-one mt_0 0.2333012 0.84735973 0.36586874
## 117 LAST LAST+one-to-one no_0 0.2340997 0.82907687 0.36510706
## 118 LAST LAST+one-to-one oy_0 0.2505499 0.85487018 0.38752266
## 119 LAST LAST+one-to-one po_0 0.3479249 0.85968512 0.49536827
## 120 LAST LAST+one-to-one rsch_4 0.2380609 0.83053641 0.37005197
## 121 LAST LAST+one-to-one sf_2 0.2548057 0.83052446 0.38996863
## 122 LAST LAST+one-to-one tsu_0 0.2295955 0.82305430 0.35903598
## 123 LAST LAST+one-to-one wil_2 0.2341155 0.83171063 0.36538113
## 124 LAST LAST+one-to-one ws_0 0.2522393 0.83016542 0.38691688
## 125 LAST LAST+one-to-one wu_0 0.2390758 0.83343002 0.37156526
## 126 LAST LAST+one-to-one zu_0 0.2443260 0.83234689 0.37776371
dat$V2 <- factor(dat$V2, levels = c("AnchorWave", "minimap2_asm5", "minimap2_asm10", "minimap2_asm20", "LAST+one-to-one", "MUMmer4", "GSAlign"))
dat$V1 <- factor(dat$V1, levels = c("AnchorWave", "minimap2", "LAST", "MUMmer4", "GSAlign"))
shape = c(16, 17, 17, 17, 7, 3, 15)
color=c("#FB766D", "#CD9600","#7CAE00","#00BE67","#22C6CA", "#D4A2FA","#FF61CC")
p =ggplot(data=dat, aes(x=V3, y=V6, color=V2, shape=V2)) + geom_point(size=3)+
scale_shape_manual(values=shape)+
scale_color_manual(values=color)+
theme_grey(base_size = 24) +
labs(x="", y="Variant sites F-Score") +
theme(axis.line = element_blank(),
legend.title = element_blank(),
panel.background = element_blank(),
panel.border = element_blank(),
axis.text.y = element_text( colour = "black"),
axis.ticks.y=element_blank(),
axis.text.x = element_text(angle=300, hjust=0, vjust=1, colour = "black") )
print(p)
png(file="ds_fscore.png",width = 960, height = 416)
p
dev.off()
## png
## 2
pdf(file="ds_fscore.pdf", width = 12, height = 5.2)
p
dev.off()
## png
## 2
d1 = dat[which(dat$V2 == "AnchorWave"),]
d5 = dat[which(dat$V2 == "minimap2_asm5"),]
d10 = dat[which(dat$V2 == "minimap2_asm10"),]
d20 = dat[which(dat$V2 == "minimap2_asm20"),]
summary(d1$V6)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9025 0.9071 0.9119 0.9124 0.9158 0.9263
summary(d5$V6)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.6872 0.7093 0.7204 0.7260 0.7325 0.8107
summary(d10$V6)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.7907 0.8002 0.8127 0.8157 0.8193 0.8758
summary(d20$V6)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.8024 0.8233 0.8298 0.8318 0.8351 0.8799
p =ggplot(data=dat, aes(x=V3, y=V4, color=V2, shape=V2)) + geom_point(size=3)+
scale_shape_manual(values=shape)+
scale_color_manual(values=color)+
theme_grey(base_size = 24) +
labs(x="", y="Variant sites recall") +
theme(axis.line = element_blank(),
legend.title = element_blank(),
panel.background = element_blank(),
panel.border = element_blank(),
axis.text.y = element_text( colour = "black"),
axis.ticks.y=element_blank(),
axis.text.x = element_text(angle=300, hjust=0, vjust=1, colour = "black") )
print(p)
png(file="ds_recall.png",width = 960, height = 416)
p
dev.off()
## png
## 2
pdf(file="ds_recall.pdf", width = 12, height = 5.2)
p
dev.off()
## png
## 2
summary(d1$V4)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.8992 0.9053 0.9080 0.9102 0.9123 0.9271
summary(d5$V4)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.5305 0.5562 0.5709 0.5787 0.5863 0.6925
summary(d10$V4)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.6701 0.6821 0.7009 0.7059 0.7102 0.7990
summary(d20$V4)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.6952 0.7254 0.7313 0.7370 0.7434 0.8094
p =ggplot(data=dat, aes(x=V3, y=V5, color=V2, shape=V2)) + geom_point(size=3)+
scale_shape_manual(values=shape)+
scale_color_manual(values=color)+
theme_grey(base_size = 24) +
labs(x="", y="Variant sites precision") +
theme(axis.line = element_blank(),
legend.title = element_blank(),
panel.background = element_blank(),
panel.border = element_blank(),
axis.text.y = element_text( colour = "black"),
axis.ticks.y=element_blank(),
axis.text.x = element_text(angle=300, hjust=0, vjust=1, colour = "black") )
print(p)
png(file="ds_precision.png",width = 960, height = 416)
p
dev.off()
## png
## 2
pdf(file="ds_precision.pdf", width = 12, height = 5.2)
p
dev.off()
## png
## 2
summary(d1$V5)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9005 0.9107 0.9161 0.9146 0.9204 0.9255
summary(d5$V5)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9721 0.9747 0.9766 0.9763 0.9779 0.9823
summary(d10$V5)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9589 0.9659 0.9674 0.9669 0.9683 0.9752
summary(d20$V5)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9361 0.9523 0.9555 0.9552 0.9588 0.9682
newd = data.frame(approach=c(as.character(dat$V2), as.character(dat$V2), as.character(dat$V2)), score=c(rep("F-score", nrow(dat)), rep("recall", nrow(dat)), rep("precision", nrow(dat))), number=c(dat$V6, dat$V4, dat$V5) )
newd$approach = factor(newd$approach, levels = c("AnchorWave", "minimap2_asm5", "minimap2_asm10", "minimap2_asm20", "LAST+one-to-one", "MUMmer4", "GSAlign"))
newd$score = factor(newd$score, levels = c("F-score", "precision", "recall"))
p = ggplot(newd, aes(x=approach, y=number, fill=score, color=score)) +geom_boxplot(width=.6) + theme_grey(base_size = 24) + ylim(0, 1)+
labs(x="Test of Arabidopsis genome alignment", y="") +
theme(axis.line = element_blank(),
legend.title = element_blank(),
panel.background = element_blank(),
panel.border = element_blank(),
axis.text.y = element_text( colour = "black"),
axis.ticks.y=element_blank(),
axis.text.x = element_text(angle=300, hjust=0, vjust=1, colour = "black") )
print(p)
png(file="ara_summary.png", width = 640, height = 416)
p
dev.off()
## png
## 2
pdf(file="ara_summary.pdf", width = 8, height = 5.2)
p
dev.off()
## png
## 2
dat = read.table("allSummaryTable")
print(dat)
## V1 V2 V3 V4 V5 V6
## 1 AnchorWave AnchorWave bur_0 0.9909252 0.9909252 0.9909252
## 2 AnchorWave AnchorWave can_0 0.9893405 0.9893405 0.9893405
## 3 AnchorWave AnchorWave ct_1 0.9930896 0.9930896 0.9930896
## 4 AnchorWave AnchorWave edi_0 0.9911888 0.9911888 0.9911888
## 5 AnchorWave AnchorWave hi_0 0.9927691 0.9927691 0.9927691
## 6 AnchorWave AnchorWave kn_0 0.9914667 0.9914667 0.9914667
## 7 AnchorWave AnchorWave ler_0 0.9913804 0.9913804 0.9913804
## 8 AnchorWave AnchorWave mt_0 0.9923720 0.9923720 0.9923720
## 9 AnchorWave AnchorWave no_0 0.9915878 0.9915878 0.9915878
## 10 AnchorWave AnchorWave oy_0 0.9932832 0.9932832 0.9932832
## 11 AnchorWave AnchorWave po_0 0.9926893 0.9926893 0.9926893
## 12 AnchorWave AnchorWave rsch_4 0.9919542 0.9919542 0.9919542
## 13 AnchorWave AnchorWave sf_2 0.9908233 0.9908233 0.9908233
## 14 AnchorWave AnchorWave tsu_0 0.9915826 0.9915826 0.9915826
## 15 AnchorWave AnchorWave wil_2 0.9912474 0.9912474 0.9912474
## 16 AnchorWave AnchorWave ws_0 0.9913823 0.9913823 0.9913823
## 17 AnchorWave AnchorWave wu_0 0.9921063 0.9921063 0.9921063
## 18 AnchorWave AnchorWave zu_0 0.9914695 0.9914695 0.9914695
## 19 minimap2 minimap2_asm5 bur_0 0.9695716 0.9988949 0.9840149
## 20 minimap2 minimap2_asm5 can_0 0.9589517 0.9983717 0.9782648
## 21 minimap2 minimap2_asm5 ct_1 0.9740352 0.9990731 0.9863953
## 22 minimap2 minimap2_asm5 edi_0 0.9691505 0.9986004 0.9836551
## 23 minimap2 minimap2_asm5 hi_0 0.9809470 0.9991470 0.9899634
## 24 minimap2 minimap2_asm5 kn_0 0.9697792 0.9986569 0.9840062
## 25 minimap2 minimap2_asm5 ler_0 0.9693708 0.9985826 0.9837599
## 26 minimap2 minimap2_asm5 mt_0 0.9725854 0.9980910 0.9851731
## 27 minimap2 minimap2_asm5 no_0 0.9703553 0.9989128 0.9844270
## 28 minimap2 minimap2_asm5 oy_0 0.9731548 0.9985456 0.9856867
## 29 minimap2 minimap2_asm5 po_0 0.9803114 0.9991080 0.9896205
## 30 minimap2 minimap2_asm5 rsch_4 0.9712933 0.9990178 0.9849605
## 31 minimap2 minimap2_asm5 sf_2 0.9655912 0.9985962 0.9818164
## 32 minimap2 minimap2_asm5 tsu_0 0.9672092 0.9987927 0.9827473
## 33 minimap2 minimap2_asm5 wil_2 0.9658447 0.9984784 0.9818904
## 34 minimap2 minimap2_asm5 ws_0 0.9690558 0.9988037 0.9837049
## 35 minimap2 minimap2_asm5 wu_0 0.9712394 0.9990425 0.9849448
## 36 minimap2 minimap2_asm5 zu_0 0.9690155 0.9990006 0.9837796
## 37 minimap2 minimap2_asm10 bur_0 0.9871980 0.9979527 0.9925462
## 38 minimap2 minimap2_asm10 can_0 0.9816048 0.9971337 0.9893083
## 39 minimap2 minimap2_asm10 ct_1 0.9891871 0.9984564 0.9938001
## 40 minimap2 minimap2_asm10 edi_0 0.9860346 0.9972820 0.9916264
## 41 minimap2 minimap2_asm10 hi_0 0.9926021 0.9982015 0.9953939
## 42 minimap2 minimap2_asm10 kn_0 0.9865419 0.9976114 0.9920457
## 43 minimap2 minimap2_asm10 ler_0 0.9861068 0.9974807 0.9917611
## 44 minimap2 minimap2_asm10 mt_0 0.9873188 0.9975197 0.9923930
## 45 minimap2 minimap2_asm10 no_0 0.9858075 0.9979861 0.9918594
## 46 minimap2 minimap2_asm10 oy_0 0.9886422 0.9982131 0.9934046
## 47 minimap2 minimap2_asm10 po_0 0.9907764 0.9985647 0.9946553
## 48 minimap2 minimap2_asm10 rsch_4 0.9871145 0.9981239 0.9925887
## 49 minimap2 minimap2_asm10 sf_2 0.9842248 0.9976645 0.9908991
## 50 minimap2 minimap2_asm10 tsu_0 0.9845270 0.9976811 0.9910604
## 51 minimap2 minimap2_asm10 wil_2 0.9838565 0.9968938 0.9903322
## 52 minimap2 minimap2_asm10 ws_0 0.9857967 0.9977720 0.9917482
## 53 minimap2 minimap2_asm10 wu_0 0.9866118 0.9982690 0.9924062
## 54 minimap2 minimap2_asm10 zu_0 0.9858900 0.9980291 0.9919224
## 55 minimap2 minimap2_asm20 bur_0 0.9900700 0.9971341 0.9935895
## 56 minimap2 minimap2_asm20 can_0 0.9857167 0.9960271 0.9908451
## 57 minimap2 minimap2_asm20 ct_1 0.9908083 0.9980363 0.9944091
## 58 minimap2 minimap2_asm20 edi_0 0.9892710 0.9963586 0.9928021
## 59 minimap2 minimap2_asm20 hi_0 0.9937239 0.9978126 0.9957640
## 60 minimap2 minimap2_asm20 kn_0 0.9887890 0.9968093 0.9927829
## 61 minimap2 minimap2_asm20 ler_0 0.9889673 0.9966437 0.9927907
## 62 minimap2 minimap2_asm20 mt_0 0.9892361 0.9969795 0.9930927
## 63 minimap2 minimap2_asm20 no_0 0.9888629 0.9972355 0.9930316
## 64 minimap2 minimap2_asm20 oy_0 0.9903122 0.9975922 0.9939389
## 65 minimap2 minimap2_asm20 po_0 0.9922585 0.9971603 0.9947034
## 66 minimap2 minimap2_asm20 rsch_4 0.9898901 0.9974536 0.9936575
## 67 minimap2 minimap2_asm20 sf_2 0.9885540 0.9966641 0.9925925
## 68 minimap2 minimap2_asm20 tsu_0 0.9872584 0.9963987 0.9918075
## 69 minimap2 minimap2_asm20 wil_2 0.9873064 0.9958714 0.9915704
## 70 minimap2 minimap2_asm20 ws_0 0.9889253 0.9967574 0.9928259
## 71 minimap2 minimap2_asm20 wu_0 0.9894740 0.9973584 0.9934006
## 72 minimap2 minimap2_asm20 zu_0 0.9888147 0.9971706 0.9929750
## 73 MUMmer4 MUMmer4 bur_0 0.9717480 0.6942250 0.8098712
## 74 MUMmer4 MUMmer4 can_0 0.9660616 0.6892856 0.8045350
## 75 MUMmer4 MUMmer4 ct_1 0.9748921 0.6907294 0.8085710
## 76 MUMmer4 MUMmer4 edi_0 0.9722103 0.6911738 0.8079508
## 77 MUMmer4 MUMmer4 hi_0 0.9806453 0.6970664 0.8148896
## 78 MUMmer4 MUMmer4 kn_0 0.9720862 0.6928318 0.8090395
## 79 MUMmer4 MUMmer4 ler_0 0.9715677 0.6932585 0.8091506
## 80 MUMmer4 MUMmer4 mt_0 0.9731358 0.6987335 0.8134159
## 81 MUMmer4 MUMmer4 no_0 0.9716089 0.6951153 0.8104283
## 82 MUMmer4 MUMmer4 oy_0 0.9751781 0.6903740 0.8084257
## 83 MUMmer4 MUMmer4 po_0 0.9804366 0.6948905 0.8133290
## 84 MUMmer4 MUMmer4 rsch_4 0.9736394 0.6932189 0.8098411
## 85 MUMmer4 MUMmer4 sf_2 0.9704588 0.6945811 0.8096651
## 86 MUMmer4 MUMmer4 tsu_0 0.9709679 0.6908501 0.8073005
## 87 MUMmer4 MUMmer4 wil_2 0.9688656 0.6961454 0.8101704
## 88 MUMmer4 MUMmer4 ws_0 0.9718818 0.6921715 0.8085184
## 89 MUMmer4 MUMmer4 wu_0 0.9734442 0.6958228 0.8115474
## 90 MUMmer4 MUMmer4 zu_0 0.9719017 0.6913087 0.8079364
## 91 GSAlign GSAlign bur_0 0.9438244 0.9923056 0.9674580
## 92 GSAlign GSAlign can_0 0.9372333 0.9913677 0.9635407
## 93 GSAlign GSAlign ct_1 0.9616130 0.9952949 0.9781641
## 94 GSAlign GSAlign edi_0 0.9430187 0.9930217 0.9673745
## 95 GSAlign GSAlign hi_0 0.9633558 0.9944615 0.9786616
## 96 GSAlign GSAlign kn_0 0.9445969 0.9930147 0.9682009
## 97 GSAlign GSAlign ler_0 0.9461290 0.9928698 0.9689361
## 98 GSAlign GSAlign mt_0 0.9494619 0.9940712 0.9712546
## 99 GSAlign GSAlign no_0 0.9481743 0.9934311 0.9702753
## 100 GSAlign GSAlign oy_0 0.9623622 0.9951682 0.9784903
## 101 GSAlign GSAlign po_0 0.9583345 0.9940997 0.9758895
## 102 GSAlign GSAlign rsch_4 0.9455843 0.9940424 0.9692080
## 103 GSAlign GSAlign sf_2 0.9425898 0.9929851 0.9671314
## 104 GSAlign GSAlign tsu_0 0.9451037 0.9929399 0.9684314
## 105 GSAlign GSAlign wil_2 0.9446415 0.9925494 0.9680031
## 106 GSAlign GSAlign ws_0 0.9459993 0.9933546 0.9690988
## 107 GSAlign GSAlign wu_0 0.9494061 0.9939377 0.9711617
## 108 GSAlign GSAlign zu_0 0.9422056 0.9931890 0.9670258
## 109 LAST LAST+one-to-one bur_0 0.9727456 0.9945424 0.9835233
## 110 LAST LAST+one-to-one can_0 0.9671269 0.9934367 0.9801053
## 111 LAST LAST+one-to-one ct_1 0.9750202 0.9959976 0.9853973
## 112 LAST LAST+one-to-one edi_0 0.9731932 0.9946412 0.9838003
## 113 LAST LAST+one-to-one hi_0 0.9816121 0.9957844 0.9886475
## 114 LAST LAST+one-to-one kn_0 0.9730049 0.9947314 0.9837482
## 115 LAST LAST+one-to-one ler_0 0.9725854 0.9947204 0.9835284
## 116 LAST LAST+one-to-one mt_0 0.9737947 0.9955436 0.9845490
## 117 LAST LAST+one-to-one no_0 0.9722921 0.9948113 0.9834228
## 118 LAST LAST+one-to-one oy_0 0.9754603 0.9960507 0.9856480
## 119 LAST LAST+one-to-one po_0 0.9814987 0.9956208 0.9885093
## 120 LAST LAST+one-to-one rsch_4 0.9743618 0.9951740 0.9846579
## 121 LAST LAST+one-to-one sf_2 0.9717076 0.9943262 0.9828868
## 122 LAST LAST+one-to-one tsu_0 0.9716948 0.9946727 0.9830495
## 123 LAST LAST+one-to-one wil_2 0.9703042 0.9944936 0.9822500
## 124 LAST LAST+one-to-one ws_0 0.9731021 0.9946898 0.9837776
## 125 LAST LAST+one-to-one wu_0 0.9741368 0.9951520 0.9845323
## 126 LAST LAST+one-to-one zu_0 0.9730070 0.9947901 0.9837780
dat$V2 <- factor(dat$V2, levels = c("AnchorWave", "minimap2_asm5", "minimap2_asm10", "minimap2_asm20", "LAST+one-to-one", "MUMmer4", "GSAlign"))
dat$V1 <- factor(dat$V1, levels = c("AnchorWave", "minimap2", "LAST", "MUMmer4", "GSAlign"))
shape = c(16, 17, 17, 17, 7, 7, 3, 15)
color=c("#FB766D", "#CD9600","#7CAE00","#00BE67","#22C6CA","#0AFA0A","#D4A2FA","#FF61CC")
p =ggplot(data=dat, aes(x=V3, y=V6, color=V2, shape=V2)) + geom_point(size=3)+
scale_shape_manual(values=shape)+
scale_color_manual(values=color)+
theme_grey(base_size = 24) +
labs(x="", y="Genome wide F-Score") +
theme(axis.line = element_blank(),
legend.title = element_blank(),
panel.background = element_blank(),
panel.border = element_blank(),
axis.text.y = element_text( colour = "black"),
axis.ticks.y=element_blank(),
axis.text.x = element_text(angle=300, hjust=0, vjust=1, colour = "black") )
print(p)
png(file="all_fscore.png",width = 960, height = 416)
p
dev.off()
## png
## 2
pdf(file="all_fscore.pdf", width = 12, height = 5.2)
p
dev.off()
## png
## 2
d1 = dat[which(dat$V2 == "AnchorWave"),]
d5 = dat[which(dat$V2 == "minimap2_asm5"),]
d10 = dat[which(dat$V2 == "minimap2_asm10"),]
d20 = dat[which(dat$V2 == "minimap2_asm20"),]
summary(d1$V6)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9893 0.9913 0.9915 0.9917 0.9923 0.9933
summary(d5$V6)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9783 0.9837 0.9840 0.9844 0.9851 0.9900
summary(d10$V6)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9893 0.9917 0.9920 0.9922 0.9926 0.9954
summary(d20$V6)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9908 0.9928 0.9930 0.9931 0.9936 0.9958
p =ggplot(data=dat, aes(x=V3, y=V4, color=V2, shape=V2)) + geom_point(size=3)+
scale_shape_manual(values=shape)+
scale_color_manual(values=color)+
theme_grey(base_size = 24) +
labs(x="", y="Genome wide recall") +
theme(axis.line = element_blank(),
legend.title = element_blank(),
panel.background = element_blank(),
panel.border = element_blank(),
axis.text.y = element_text( colour = "black"),
axis.ticks.y=element_blank(),
axis.text.x = element_text(angle=300, hjust=0, vjust=1, colour = "black") )
print(p)
png(file="all_recall.png",width = 960, height = 416)
p
dev.off()
## png
## 2
pdf(file="all_recall.pdf", width = 12, height = 5.2)
p
dev.off()
## png
## 2
summary(d1$V4)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9893 0.9913 0.9915 0.9917 0.9923 0.9933
summary(d5$V4)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9590 0.9690 0.9697 0.9704 0.9723 0.9809
summary(d10$V4)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9816 0.9858 0.9863 0.9867 0.9873 0.9926
summary(d20$V4)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9857 0.9888 0.9891 0.9893 0.9900 0.9937
p =ggplot(data=dat, aes(x=V3, y=V5, color=V2, shape=V2)) + geom_point(size=3, alpha=0.4)+
scale_shape_manual(values=shape)+
scale_color_manual(values=color)+
theme_grey(base_size = 24) +
labs(x="", y="Genome wide precision") +
theme(axis.line = element_blank(),
legend.title = element_blank(),
panel.background = element_blank(),
panel.border = element_blank(),
axis.text.y = element_text( colour = "black"),
axis.ticks.y=element_blank(),
axis.text.x = element_text(angle=300, hjust=0, vjust=1, colour = "black") )
print(p)
png(file="all_precision.png",width = 960, height = 416)
p
dev.off()
## png
## 2
pdf(file="all_precision.pdf", width = 12, height = 5.2)
p
dev.off()
## png
## 2
summary(d1$V5)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9893 0.9913 0.9915 0.9917 0.9923 0.9933
summary(d5$V5)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9981 0.9986 0.9988 0.9988 0.9990 0.9991
summary(d10$V5)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9969 0.9975 0.9979 0.9978 0.9982 0.9986
summary(d20$V5)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 0.9959 0.9966 0.9971 0.9970 0.9973 0.9980
faidx = read.table("tair10.fa.fai")
genome_size = sum(faidx$V2)
dat = read.table("depth")
print(dat)
## V1 V2 V3 V4
## 1 AnchorWave AnchorWave bur_0 119146348
## 2 AnchorWave AnchorWave can_0 119146348
## 3 AnchorWave AnchorWave ct_1 119146348
## 4 AnchorWave AnchorWave edi_0 119146348
## 5 AnchorWave AnchorWave hi_0 119146348
## 6 AnchorWave AnchorWave kn_0 119146348
## 7 AnchorWave AnchorWave ler_0 119146348
## 8 AnchorWave AnchorWave mt_0 119146348
## 9 AnchorWave AnchorWave no_0 119146348
## 10 AnchorWave AnchorWave oy_0 119146348
## 11 AnchorWave AnchorWave po_0 119146348
## 12 AnchorWave AnchorWave rsch_4 119146348
## 13 AnchorWave AnchorWave sf_2 119146348
## 14 AnchorWave AnchorWave tsu_0 119146348
## 15 AnchorWave AnchorWave wil_2 119146348
## 16 AnchorWave AnchorWave ws_0 119146348
## 17 AnchorWave AnchorWave wu_0 119146348
## 18 AnchorWave AnchorWave zu_0 119146348
## 19 minimap2 minimap2_asm5 bur_0 115638484
## 20 minimap2 minimap2_asm5 can_0 114399489
## 21 minimap2 minimap2_asm5 ct_1 116142751
## 22 minimap2 minimap2_asm5 edi_0 115612655
## 23 minimap2 minimap2_asm5 hi_0 116970734
## 24 minimap2 minimap2_asm5 kn_0 115690944
## 25 minimap2 minimap2_asm5 ler_0 115625003
## 26 minimap2 minimap2_asm5 mt_0 116061866
## 27 minimap2 minimap2_asm5 no_0 115729499
## 28 minimap2 minimap2_asm5 oy_0 116038081
## 29 minimap2 minimap2_asm5 po_0 116900714
## 30 minimap2 minimap2_asm5 rsch_4 115838689
## 31 minimap2 minimap2_asm5 sf_2 115202451
## 32 minimap2 minimap2_asm5 tsu_0 115374653
## 33 minimap2 minimap2_asm5 wil_2 115234788
## 34 minimap2 minimap2_asm5 ws_0 115589453
## 35 minimap2 minimap2_asm5 wu_0 115825207
## 36 minimap2 minimap2_asm5 zu_0 115566240
## 37 minimap2 minimap2_asm10 bur_0 117842701
## 38 minimap2 minimap2_asm10 can_0 117230244
## 39 minimap2 minimap2_asm10 ct_1 118019830
## 40 minimap2 minimap2_asm10 edi_0 117770264
## 41 minimap2 minimap2_asm10 hi_0 118427517
## 42 minimap2 minimap2_asm10 kn_0 117810732
## 43 minimap2 minimap2_asm10 ler_0 117727050
## 44 minimap2 minimap2_asm10 mt_0 117884198
## 45 minimap2 minimap2_asm10 no_0 117674955
## 46 minimap2 minimap2_asm10 oy_0 117959030
## 47 minimap2 minimap2_asm10 po_0 118213472
## 48 minimap2 minimap2_asm10 rsch_4 117819102
## 49 minimap2 minimap2_asm10 sf_2 117527973
## 50 minimap2 minimap2_asm10 tsu_0 117561718
## 51 minimap2 minimap2_asm10 wil_2 117481406
## 52 minimap2 minimap2_asm10 ws_0 117704171
## 53 minimap2 minimap2_asm10 wu_0 117744132
## 54 minimap2 minimap2_asm10 zu_0 117677030
## 55 minimap2 minimap2_asm20 bur_0 118286906
## 56 minimap2 minimap2_asm20 can_0 117863761
## 57 minimap2 minimap2_asm20 ct_1 118271832
## 58 minimap2 minimap2_asm20 edi_0 118205895
## 59 minimap2 minimap2_asm20 hi_0 118601745
## 60 minimap2 minimap2_asm20 kn_0 118171139
## 61 minimap2 minimap2_asm20 ler_0 118167619
## 62 minimap2 minimap2_asm20 mt_0 118154561
## 63 minimap2 minimap2_asm20 no_0 118132231
## 64 minimap2 minimap2_asm20 oy_0 118234858
## 65 minimap2 minimap2_asm20 po_0 118493684
## 66 minimap2 minimap2_asm20 rsch_4 118229122
## 67 minimap2 minimap2_asm20 sf_2 118167364
## 68 minimap2 minimap2_asm20 tsu_0 118010256
## 69 minimap2 minimap2_asm20 wil_2 117979851
## 70 minimap2 minimap2_asm20 ws_0 118182624
## 71 minimap2 minimap2_asm20 wu_0 118185529
## 72 minimap2 minimap2_asm20 zu_0 118116594
## 73 MUMmer4 MUMmer4 bur_0 117501494
## 74 MUMmer4 MUMmer4 can_0 116957345
## 75 MUMmer4 MUMmer4 ct_1 117534600
## 76 MUMmer4 MUMmer4 edi_0 117456778
## 77 MUMmer4 MUMmer4 hi_0 118110626
## 78 MUMmer4 MUMmer4 kn_0 117460141
## 79 MUMmer4 MUMmer4 ler_0 117480406
## 80 MUMmer4 MUMmer4 mt_0 117641436
## 81 MUMmer4 MUMmer4 no_0 117471684
## 82 MUMmer4 MUMmer4 oy_0 117591596
## 83 MUMmer4 MUMmer4 po_0 118063447
## 84 MUMmer4 MUMmer4 rsch_4 117606017
## 85 MUMmer4 MUMmer4 sf_2 117398356
## 86 MUMmer4 MUMmer4 tsu_0 117244786
## 87 MUMmer4 MUMmer4 wil_2 117248721
## 88 MUMmer4 MUMmer4 ws_0 117200107
## 89 MUMmer4 MUMmer4 wu_0 117647880
## 90 MUMmer4 MUMmer4 zu_0 117180156
## 91 LAST LAST+one-to-one bur_0 116535087
## 92 LAST LAST+one-to-one can_0 115990922
## 93 LAST LAST+one-to-one ct_1 116636925
## 94 LAST LAST+one-to-one edi_0 116577128
## 95 LAST LAST+one-to-one hi_0 117450627
## 96 LAST LAST+one-to-one kn_0 116543998
## 97 LAST LAST+one-to-one ler_0 116495043
## 98 LAST LAST+one-to-one mt_0 116543443
## 99 LAST LAST+one-to-one no_0 116449271
## 100 LAST LAST+one-to-one oy_0 116683351
## 101 LAST LAST+one-to-one po_0 117456352
## 102 LAST LAST+one-to-one rsch_4 116654627
## 103 LAST LAST+one-to-one sf_2 116436046
## 104 LAST LAST+one-to-one tsu_0 116393956
## 105 LAST LAST+one-to-one wil_2 116248313
## 106 LAST LAST+one-to-one ws_0 116560520
## 107 LAST LAST+one-to-one wu_0 116630262
## 108 LAST LAST+one-to-one zu_0 116537386
## 109 GSAlign GSAlign bur_0 113182691
## 110 GSAlign GSAlign can_0 112518107
## 111 GSAlign GSAlign ct_1 115089788
## 112 GSAlign GSAlign edi_0 113050120
## 113 GSAlign GSAlign hi_0 115370837
## 114 GSAlign GSAlign kn_0 113219600
## 115 GSAlign GSAlign ler_0 113441451
## 116 GSAlign GSAlign mt_0 113732633
## 117 GSAlign GSAlign no_0 113644732
## 118 GSAlign GSAlign oy_0 115168751
## 119 GSAlign GSAlign po_0 114786386
## 120 GSAlign GSAlign rsch_4 113278701
## 121 GSAlign GSAlign sf_2 113020892
## 122 GSAlign GSAlign tsu_0 113309141
## 123 GSAlign GSAlign wil_2 113314047
## 124 GSAlign GSAlign ws_0 113380227
## 125 GSAlign GSAlign wu_0 113748726
## 126 GSAlign GSAlign zu_0 112934517
dat$V2 <- factor(dat$V2, levels = c("AnchorWave", "minimap2_asm5", "minimap2_asm10", "minimap2_asm20", "LAST+one-to-one", "MUMmer4", "GSAlign"))
dat$V1 <- factor(dat$V1, levels = c("AnchorWave", "minimap2", "LAST", "MUMmer4", "GSAlign"))
p =ggplot(data=dat, aes(x=V3, y=V4/genome_size, color=V2, shape=V2)) + geom_point(size=3) +
scale_shape_manual(values=shape)+
scale_color_manual(values=color)+
theme_grey(base_size = 24) +
labs(x="", y="Proportion of aligned sites") +
theme(axis.line = element_blank(),
legend.title = element_blank(),
panel.background = element_blank(),
panel.border = element_blank(),
axis.text.y = element_text( colour = "black"),
axis.ticks.y=element_blank(),
axis.text.x = element_text(angle=300, hjust=0, vjust=1, colour = "black") )
print(p)
png(file="aligned_sites.png",width = 960, height = 416)
p
dev.off()
## png
## 2
pdf(file="aligned_sites.pdf", width = 12, height = 5.2)
p
dev.off()
## png
## 2
d1 = dat[which(dat$V2 == "AnchorWave"),]
d5 = dat[which(dat$V2 == "minimap2_asm5"),]
d10 = dat[which(dat$V2 == "minimap2_asm10"),]
d20 = dat[which(dat$V2 == "minimap2_asm20"),]
summary(d1$V4)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 119146348 119146348 119146348 119146348 119146348 119146348
summary(d5$V4)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 114399489 115572043 115664714 115746761 115988233 116970734
summary(d10$V4)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 117230244 117675474 117757198 117781974 117873824 118427517
summary(d20$V4)
## Min. 1st Qu. Median Mean 3rd Qu. Max.
## 117863761 118137814 118176882 118191976 118233424 118601745
something for the purpose of creating the IGV screen in the supplementary materials
cp bur_0_lastal_final_split.bam bur_0_lastal_one-to-one.bam
samtools index bur_0_lastal_one-to-one.bam
cp minimap2_bur_0.bam minimap2_asm10_bur_0.bam
samtools index minimap2_asm10_bur_0.bam
maf-convert sam col_bur.maf | sed 's/query.//g' | sed 's/col.//g' | samtools view -O BAM --reference tair10.fa - | samtools sort - > bur_0_benchmark.bam; samtools index bur_0_benchmark.bam